Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000059b0
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATAAGAACAAATGTTTGTAT - [1832200, 1832220] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pcrA ligA lmo1757 lmo1760
Gene Locus tag Description
pcrA lmo1759 ATP-dependent DNA helicase
ligA lmo1758 similar to DNA ligase
lmo1757 lmo1757 hypothetical protein
lmo1760 lmo1760 geranylgeranylglyceryl phosphate synthase-like protein