Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005990
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACACGAACACACTTTCTTTT - [1616877, 1616897] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dnaE lmo1575 lmo1576 lmo1577
Gene Locus tag Description
dnaE lmo1574 highly similar to DNA polymerase III (alpha subunit) DnaE
lmo1575 lmo1575 hypothetical protein
lmo1576 lmo1576 hypothetical protein
lmo1577 lmo1577 metal-dependent hydrolase