Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005980
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTGCGAACGTAGGTTCTGTG + [153552, 153572] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo0157 lmo0158 lmo0156 lmo0155 lmo0154 lmo0153
Gene Locus tag Description
lmo0157 lmo0157 similar to ATP dependent helicase
lmo0158 lmo0158 hypothetical protein
lmo0156 lmo0156 lmo0156
lmo0155 lmo0155 similar to high-affinity zinc ABC transporter (membrane protein)
lmo0154 lmo0154 similar to high-affinity zinc ABC transporter (ATP-binding protein)
lmo0153 lmo0153 similar to a probable high-affinity zinc ABC transporter (Zn(II)-binding lipoprotein)