Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005970
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATAAGAACGCTTGTTCGTTT - [2048531, 2048551] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 337

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo1975 lmo1976 lmo1977
Gene Locus tag Description
lmo1975 lmo1975 similar to E. coli DNA-damage-inducible protein dinP
lmo1976 lmo1976 similar to oxidoreductase
lmo1977 lmo1977 hypothetical protein