Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005960
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATATAGAACATACATTCGATT + [1451771, 1451791] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 337

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo1421 lmo1422 murB lmo1419 lmo1423
Gene Locus tag Description
lmo1421 lmo1421 similar to glycine betaine/carnitine/choline ABC transporter (ATP-binding protein)
lmo1422 lmo1422 similar to glycine betaine/carnitine/choline ABC transporter (membrane protein)
murB lmo1420 weakly similar to UDP-N-acetylglucosaminyl-3-enolpyruvate reductase
lmo1419 lmo1419 hypothetical protein
lmo1423 lmo1423 lmo1423