Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005950
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATACGAATAAATGTTCGCTT + [1425278, 1425298] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 337

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... recA cinA
Gene Locus tag Description
recA lmo1398 recombinase A
cinA lmo1397 similar to competence-damage inducible protein CinA