Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005390
Genome
Vibrio cholerae - NC_002505.1
TF
LexA [UniProtKB:Q9KVP9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGCTGTTTTTTTGTACATTA - [1565971, 1565990] 15664197 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 304

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1454 VC1453 VC1455
Gene Locus tag Description
VC1454 VC1454 RstA1 protein
VC1453 VC1453 RstB1 protein
VC1455 VC1455 transcriptional repressor RstR