Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005130
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GACTGTATAAAACCACAGCC - [65834, 65853] 10760155 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 288

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... polB araD
Gene Locus tag Description
polB b0060 DNA polymerase II
araD b0061 L-ribulose-5-phosphate 4-epimerase