Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000050e0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGTATATAAAAACAGTA + [1229951, 1229970] 10760155 Experimental technique details Northern blot (ECO:0005653) - Experimental technique details PSSM site search (ECO:0005659) - 286

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... umuD umuC hlyE dsbB
Gene Locus tag Description
umuD b1183 DNA polymerase V, subunit D
umuC b1184 DNA polymerase V, subunit C
hlyE b1182 hemolysin E
dsbB b1185 oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I