Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000050d0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTGGATAAAATTACAGGG + [2194469, 2194488] 10760155 Experimental technique details Northern blot (ECO:0005653) - Experimental technique details PSSM site search (ECO:0005659) - 286

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yehH metG yehI
Gene Locus tag Description
yehH b4499 pseudo
metG b2114 methionyl-tRNA synthetase
yehI b2118 conserved protein