Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004fc0
Genome
Bacillus subtilis - NC_000964.3
TF
Zur [UniProtKB:P54479, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTAAATCGTAATCATTCTA + [366024, 366043] 9811636 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 279

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yciC yczL yciB yciA yckA yckB
Gene Locus tag Description
yciC BSU03360 metallochaperone with NTPase activity
yczL BSU03359 hypothetical protein
yciB BSU03350 metal uptake system lipoprotein
yciA BSU03340 GTP cyclohydrolase
yckA BSU03370 ABC transporter permease
yckB BSU03380 ABC transporter binding lipoprotein