Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004ed0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
AlgR [UniProtKB:P26275, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCCTGCCGTTCATCCTCCTT - [3889859, 3889878] 17766417 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 271

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rhlI rhlR
Gene Locus tag Description
rhlI PA3476 autoinducer synthesis protein RhlI
rhlR PA3477 transcriptional regulator RhlR