Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004ea0
Genome
Neisseria gonorrhoeae - NC_002946.2
TF
Fur [UniProtKB:Q5F5Y9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAGATCTTAAGAAACGTCTTT - [1797654, 1797674] 12081969 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 269

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... secY infA rplO rpmD rpsE rplR rplF rpsH rpsN rplE rplX rplN
Gene Locus tag Description
secY NGO1822 preprotein translocase subunit SecY
infA NGO18211 translation initiation factor IF-1
rplO NGO1823 50S ribosomal protein L15
rpmD NGO18231 50S ribosomal protein L30
rpsE NGO1824 30S ribosomal protein S5
rplR NGO18241 50S ribosomal protein L18
rplF NGO1825 50S ribosomal protein L6
rpsH NGO1826 30S ribosomal protein S8
rpsN NGO18261 30S ribosomal protein S14
rplE NGO1827 50S ribosomal protein L5
rplX NGO1828 50S ribosomal protein L24
rplN NGO1829 50S ribosomal protein L14