Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004e90
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
AlgR [UniProtKB:P26275, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCGAGCCGTTCGTCGAGCGC - [3893924, 3893943] 17766417 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 268

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rhlA PA3480 PA3481
Gene Locus tag Description
rhlA PA3479 rhamnosyltransferase chain A
PA3480 PA3480 deoxycytidine triphosphate deaminase
PA3481 PA3481 hypothetical protein