Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004db0
Genome
Mycobacterium tuberculosis - NC_000962.3
TF
Zur [UniProtKB:P9WN85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATAATGAAAATCATGTTCAGTAAGC + [341942, 341967] 17098899 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 260

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PPE3 eccA3 Rv0281 eccB3 eccC3 PE5 PPE4 esxG esxH espG3 eccD3 mycP3 eccE3 Rv0293c
Gene Locus tag Description
PPE3 Rv0280 PPE family protein PPE3
eccA3 Rv0282 ESX conserved component EccA3 ESX-3 type VII secretion system protein
Rv0281 Rv0281 Possible S-adenosylmethionine-dependent methyltransferase
eccB3 Rv0283 ESX conserved component EccB3 ESX-3 type VII secretion system protein Possible membrane protein
eccC3 Rv0284 ESX conserved component EccC3 ESX-3 type VII secretion system protein Possible membrane protein
PE5 Rv0285 PE family protein PE5
PPE4 Rv0286 PPE family protein PPE4
esxG Rv0287 ESAT-6 like protein EsxG (conserved protein TB9.8)
esxH Rv0288 Low molecular weight protein antigen 7 EsxH (10 kDa antigen) (CFP-7) (protein TB10.4)
espG3 Rv0289 ESX-3 secretion-associated protein EspG3
eccD3 Rv0290 ESX conserved component EccD3 ESX-3 type VII secretion system protein Probable transmembrane protein
mycP3 Rv0291 Probable membrane-anchored mycosin MycP3 (serine protease) (subtilisin-like protease) (subtilase-like) (mycosin-3)
eccE3 Rv0292 ESX conserved component EccE3 ESX-3 type VII secretion system protein Probable transmembrane protein
Rv0293c Rv0293c hypothetical protein