Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004d90
Genome
Mycobacterium tuberculosis - NC_000962.3
TF
Zur [UniProtKB:P9WN85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAATAATGAAAACTGTTATCGATAAG + [2315141, 2315166] 17098899 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 260

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Rv2059 rpmB2 rpmG1 rpsN2 rpsR2 Rv2060 Rv2061c
Gene Locus tag Description
Rv2059 Rv2059 hypothetical protein
rpmB2 Rv2058c 50S ribosomal protein L28 RpmB2
rpmG1 Rv2057c 50S ribosomal protein L33 RpmG1
rpsN2 Rv2056c 30S ribosomal protein S14 RpsN2
rpsR2 Rv2055c 30S ribosomal protein S18 RpsR2
Rv2060 Rv2060 Possible conserved integral membrane protein
Rv2061c Rv2061c hypothetical protein