Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004d70
Genome
Mycobacterium tuberculosis - NC_000962.3
TF
Zur [UniProtKB:P9WN85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCTGTTGAAAATAGTTTTCGACAACC + [124287, 124312] 17098899 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 260

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rpmB1 Rv0106
Gene Locus tag Description
rpmB1 Rv0105c 50S ribosomal protein L28-1 RpmB1
Rv0106 Rv0106 hypothetical protein