Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004430
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTTGTTGTTATTTTAAAGGTGACGGTGTCACGTTTTTCGGGATAGGGCAGT + [1399825, 1399877] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... abgB abgT ogt abgA
Gene Locus tag Description
abgB b1337 p-aminobenzoyl-glutamate hydrolase, B subunit
abgT b1336 p-aminobenzoyl-glutamate transporter; membrane protein
ogt b1335 O-6-alkylguanine-DNA:cysteine-protein methyltransferase
abgA b1338 p-aminobenzoyl-glutamate hydrolase, A subunit