Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004240
Genome
Escherichia coli - NC_000913.2
TF
MntR [UniProtKB:P0A9F1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTAAGTATAGCACCGGCTATGTGTT + [848177, 848202] 21239586 Experimental technique details Beta-gal reporter assay - Experimental technique details ChIP-chip (ECO:0006007) - 163

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dps rhtA
Gene Locus tag Description
dps b0812 Fe-binding and storage protein
rhtA b0813 threonine and homoserine efflux system