Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004230
Genome
Escherichia coli - NC_000913.2
TF
MntR [UniProtKB:P0A9F1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGAAACATAGCAAAGGCTATGTTTT - [2510740, 2510765] 21239586 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - 162

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mntH nupC
Gene Locus tag Description
mntH b2392 manganese/divalent cation transporter
nupC b2393 nucleoside (except guanosine) transporter