Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004200
Genome
Escherichia coli - NC_000913.2
TF
MntR [UniProtKB:P0A9F1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACAGATATAGCACAGGCTATATTAT + [852274, 852299] 21239586 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - 162

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rybA yliL mntR ybiR
Gene Locus tag Description
rybA b4416 ncRNA
yliL b0816 predicted protein
mntR b0817 DNA-binding transcriptional regulator of mntH
ybiR b0818 predicted transporter