Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000018a0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCATGTTGAAATAGCCAGTA - [3958235, 3958254] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gpp rep ppiC yifN
Gene Locus tag Description
gpp b3779 guanosine pentaphosphatase/exopolyphosphatase
rep b3778 DNA helicase and single-stranded DNA-dependent ATPase
ppiC b3775 peptidyl-prolyl cis-trans isomerase C (rotamase C)
yifN b3777 pseudo