Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001870
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCTGTATATATACCCAGCT + [3995930, 3995949] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yifL uvrD dapF yigA xerC yigB
Gene Locus tag Description
yifL b4558 predicted lipoprotein
uvrD b3813 DNA-dependent ATPase I and helicase II
dapF b3809 diaminopimelate epimerase
yigA b3810 conserved protein, DUF484 family
xerC b3811 site-specific tyrosine recombinase
yigB b3812 FMN phosphatase