Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000017e0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTGTTTTTTTATCCAGTA + [812655, 812674] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... bioB bioF bioC bioD uvrB
Gene Locus tag Description
bioB b0775 biotin synthase
bioF b0776 8-amino-7-oxononanoate synthase
bioC b0777 malonyl-CoA methyltransferase, SAM-dependent
bioD b0778 dethiobiotin synthetase
uvrB b0779 excinulease of nucleotide excision repair, DNA damage recognition component