Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001750
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGTATAAAATCACAGTT - [1928789, 1928808] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yebG purT
Gene Locus tag Description
yebG b1848 conserved protein regulated by LexA
purT b1849 phosphoribosylglycinamide formyltransferase 2