Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001730
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTGTATATAAATACAGTT + [3815720, 3815739] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dinD yicC
Gene Locus tag Description
dinD b3645 DNA-damage-inducible protein
yicC b3644 conserved protein, UPF0701 family