Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001710
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGTTTATTTATACAGTA + [3851322, 3851341] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... istR tisB
Gene Locus tag Description
istR b4616 ncRNA
tisB b4618 lexA-regulated toxic peptide involved in persister formation; membrane peptide that decreases proton motive force and ATP levels