Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000016c0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCTGTATATACTCACAGCA + [4255091, 4255110] 16264194 Experimental technique details GST pull-down assay (ECO:0005640) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - 68

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dinF lexA dgkA
Gene Locus tag Description
dinF b4044 DNA-damage-inducible SOS response protein
lexA b4043 DNA-binding transcriptional repressor of SOS regulon
dgkA b4042 diacylglycerol kinase