Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000016b0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGTATATAAAACCAGTT + [2749749, 2749768] 16264194 Experimental technique details GST pull-down assay (ECO:0005640) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - 68

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... nadK recN
Gene Locus tag Description
nadK b2615 NAD kinase
recN b2616 recombination and repair protein