Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001640
Genome
Mycobacterium tuberculosis - NC_018143.1
TF
DosR [UniProtKB:I6XGD8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACAGGGTCAATGGTCCCCAA - [2279060, 2279079] 12694625 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 65

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RVBD_2031c RVBD_2030c RVBD_2032 RVBD_2028c RVBD_2029c
Gene Locus tag Description
RVBD_2031c RVBD_2031c heat shock protein hspX
RVBD_2030c RVBD_2030c erythromycin esterase
RVBD_2032 RVBD_2032 hypothetical protein
RVBD_2028c RVBD_2028c universal stress protein
RVBD_2029c RVBD_2029c 1-phosphofructokinase family hexose kinase