Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001540
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACCTGTACATCCATCCAGATA + [4530072, 4530093] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... topB PP_4017 PP_4018
Gene Locus tag Description
topB PP_4019 DNA topoisomerase III
PP_4017 PP_4017 cupin
PP_4018 PP_4018 acetyltransferase