Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001530
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTACTGTACGAATATACAGCTA - [4300613, 4300634] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_3774 PP_3773 PP_3771 PP_3772
Gene Locus tag Description
PP_3774 PP_3774 alginate lyase 2
PP_3773 PP_3773 hypothetical protein
PP_3771 PP_3771 hypothetical protein
PP_3772 PP_3772 phage repressor