Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000014e0
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGCTGTATATAAATACAGTGT + [2405464, 2405485] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_2109 PP_2108 PP_2110
Gene Locus tag Description
PP_2109 PP_2109 hypothetical protein
PP_2108 PP_2108 peptidase M15A
PP_2110 PP_2110