Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001300
Genome
Vibrio cholerae - NC_009457.1
TF
CRP [UniProtKB:O34015, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATGCAATCGAGTTCTCATTA + [379472, 379493] 11489126 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 45

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... tcpP tcpI tcpH
Gene Locus tag Description
tcpP VC0395_A0351 toxin co-regulated pilus biosynthesis protein P
tcpI VC0395_A0350 toxin co-regulated pilus biosynthesis protein I
tcpH VC0395_A0352 toxin co-regulated pilus biosynthesis protein H