Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e80
Genome
Mycobacterium sp. JLS - NC_009077.1
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTAACTGGTCAGACCACTTGAC + [2867329, 2867351] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 25

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Mjls_2756 Mjls_2755 Mjls_2757 Mjls_2758 Mjls_2759
Gene Locus tag Description
Mjls_2756 Mjls_2756 hypothetical protein
Mjls_2755 Mjls_2755 XRE family transcriptional regulator
Mjls_2757 Mjls_2757 GntR family transcriptional regulator
Mjls_2758 Mjls_2758 fatty acid hydroxylase
Mjls_2759 Mjls_2759 ErfK/YbiS/YcfS/YnhG family protein