Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e70
Genome
Nocardia farcinica - NC_006361.1
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACGATTGGTCTTACCACTTGA - [153085, 153105] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 24

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... nfa1630 nfa1620 nfa1640 nfa1650 nfa1660 nfa1670 nfa1680 nfa1690
Gene Locus tag Description
nfa1630 nfa1630 transcriptional regulator
nfa1620 nfa1620 hypothetical protein
nfa1640 nfa1640 hypothetical protein
nfa1650 nfa1650 ABC transporter substrate-binding protein
nfa1660 nfa1660 ABC transporter
nfa1670 nfa1670 ABC transporter ATP-binding protein
nfa1680 nfa1680 ABC transporter permease
nfa1690 nfa1690 ABC transporter permease