Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e60
Genome
Mycobacterium vanbaalenii - NC_008726.1
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACACTGGTCTGACCACTTGA + [3116632, 3116652] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 23

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Mvan_2941 Mvan_2940 Mvan_2939 Mvan_2942 Mvan_2943
Gene Locus tag Description
Mvan_2941 Mvan_2941 hypothetical protein
Mvan_2940 Mvan_2940 PilT domain-containing protein
Mvan_2939 Mvan_2939 prevent-host-death family protein
Mvan_2942 Mvan_2942 regulatory protein GntR
Mvan_2943 Mvan_2943 fatty acid hydroxylase