Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e40
Genome
Mycobacterium smegmatis - NC_008596.1
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCACTGGTAAGACCACTTGA + [3589418, 3589438] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 21

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... MSMEG_3526 MSMEG_3525 MSMEG_3527 MSMEG_3529 MSMEG_3528
Gene Locus tag Description
MSMEG_3526 MSMEG_3526 hypothetical protein
MSMEG_3525 MSMEG_3525 XRE family transcriptional regulator
MSMEG_3527 MSMEG_3527 HTH-type transcriptional regulator
MSMEG_3529 MSMEG_3529 fatty acid hydroxylase
MSMEG_3528 MSMEG_3528 ErfK/YbiS/YcfS/YnhG family protein