Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e20
Genome
Mycobacterium sp. KMS - NC_008705.1
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTAACTGGTCAGACCACTTGAC + [2892901, 2892923] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 19

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Mkms_2770 Mkms_2769 Mkms_2771 Mkms_2772 Mkms_2773
Gene Locus tag Description
Mkms_2770 Mkms_2770 hypothetical protein
Mkms_2769 Mkms_2769 XRE family transcriptional regulator
Mkms_2771 Mkms_2771 GntR family transcriptional regulator
Mkms_2772 Mkms_2772 fatty acid hydroxylase
Mkms_2773 Mkms_2773 ErfK/YbiS/YcfS/YnhG family protein