Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e10
Genome
Mycobacterium avium - NC_002944.2
TF
Mce2R [UniProtKB:P9WMG5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCCGGTGGTCTGACCACCTGA + [4550914, 4550934] 18329386 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 18

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... MAP4080c MAP4081 MAP4082 MAP4083
Gene Locus tag Description
MAP4080c MAP4080c hypothetical protein
MAP4081 MAP4081 hypothetical protein
MAP4082 MAP4082 hypothetical protein
MAP4083 MAP4083 hypothetical protein