Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000c10
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTTATTGAGGAGGCATTGAAGC - [3014511, 3014533] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... orgA orgC prgH orgB prgK prgJ prgI
Gene Locus tag Description
orgA STM2870 needle complex assembly protein
orgC STM2868 hypothetical protein
prgH STM2874 needle complex inner membrane protein
orgB STM2869 needle complex export protein
prgK STM2871 needle complex inner membrane lipoprotein
prgJ STM2872 needle complex minor subunit
prgI STM2873 needle complex major subunit