Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000bc0
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCTGTTTATGGGCGGCGTCGGC - [744515, 744537] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... nagB nagA nagC nagD nagE
Gene Locus tag Description
nagB STM0684 glucosamine-6-phosphate deaminase
nagA STM0683 N-acetylglucosamine-6-phosphate deacetylase
nagC STM0682 N-acetylglucosamine operon transcriptional repressor
nagD STM0681 UMP phosphatase
nagE STM0685 PTS system N-acetyl glucosamine specific transporter subunit IIABC