Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000ad0
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTTATTGAGGTTGTATTGATAA + [1182213, 1182235] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pipD copS copR
Gene Locus tag Description
pipD STM1094 pathogenicity island-encoded protein D
copS STM1095 copper resistance protein
copR STM1096 transcriptional regulatory protein YedW