Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000590
Genome
Escherichia coli - NC_000913.2
TF
CRP [UniProtKB:P0ACJ8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTATGAAGCCCTTCACAGAA + [1486144, 1486165] 9202484 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 7

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydcF aldA gapC
Gene Locus tag Description
ydcF b1414 conserved SAM-binding protein, DUF218 superfamily
aldA b1415 aldehyde dehydrogenase A, NAD-linked
gapC b4493 pseudo