Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000040
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACCTGTATATAAATACAGTAT - [2132042, 2132063] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2033 VP2034 VP2035 VP2036
Gene Locus tag Description
VP2033 VP2033 short chain dehydrogenase
VP2034 VP2034 hypothetical protein
VP2035 VP2035 hypothetical protein
VP2036 VP2036 DNA polymerase III alpha chain