Fur - UniProtKB: Q9ZM26 regulon and binding site collection of Helicobacter pylori J99


Sites are listed as curated.

AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_000921.1 Q9ZM26 not specified AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG +[1102689:1102731] Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNAse protection (ECO:0000288) sodF (jhp0992) , tpx (jhp0991) , jhp0993
    ... ... sodF tpx jhp0993
    702 19399190

    All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.


    Sites are listed as curated.

    AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG
    Download data in FASTA format.
    Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
    Download raw data in TSV format. All reported sites are exported individually.
    Download data in Attribute-Relation File Format (ARFF).
    Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
    Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
    Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.