AmrZ - UniProtKB: G3XCY4 regulon and binding site collection of Pseudomonas aeruginosa PAO1


Sites are listed as curated.

GCCACTATCGACGAA
CCTATCGCCATGA
CTCTATGCTATCA
CATAGAGCCATCA
CAAGGCGCCATTA
CGCCTTGCCATTA
CAGAACGCCACCT
CCTTTTGCCAGCA
CGCTTGGCCACCA
CGGATTGGTATCA
CAGGCTGCCATCC
CAGATCGATATCG
CAGAAGGCCAGCC
CAACTAGCTATCA
CTAGTTGCCGGCA
CACAAAGCCATGA
TATTTCGCCATTA
CTGCTCGCCATCA
TCATTCGCCATCA
CCGTTCGCCATCC
CCGATCGCCAGTA
CAAATCGCCAGCG
CATATTGCCATTA
CAATATGCCAACG
CAGCTTGCCAATA
CAAGCTGCTATCA
TCCAGCGCCATCA
CGAAATGCCATTA
CATTTCGCTATGA
CAAAGCGCTATCA
CATTATGCTATCG
CAGGTTGCCATCA
CAGTGTGCCAGCG
CACAGTGCCATTA
CATCTGGCTATCA
CAAAACGCCATCA
CAGCTCGCCGCCG
CAAAAGGCCATTA
CCTTTTGTCATCA
CAGTGGGCCACCA
CAATGCGCCAGCA
TCAATGGCCATCA
GAACTTGCCATCG
CAGTTTCCCATCG
CAAATAGCCATTA
CGAATCGCGATCC
CACAGTGCTATCA
CGAAAGGCCACTA
CACAATGACATCA
CAGTTCGCCGCCA
ACGATCGCCATCA
CTGGTCGCCACCA
CTGTTCGCCAGCT
CAGGTGGCCACGA
CCCTTCGCTACCA
CGGATCGCCTCCA
CAGCATGCCATCG
CAGTACGGCATCC
CTATTCGGCAGCA
CGAATGGCCGGCA
CAAATAGCCATCA
CACTTTGCTATCA
CAATTGGCCATAC
CAGTCTGCCGTCA
CAGACTGCAACCA
CAGAAGGCCAACG
CACAATGCCACCC
GAGGTTGCCACCA
CAGCACGCCATCG
CGCTGTGCCATCA
CTTTCCGCCATCA
ACGATGGCCAGCA
CAGAGTGCCGCCA
CAAATTGCCATCA
CATTTCGCCACCT
CAAGTCGCCATCA
CAATCTGCCATCG
CAGATTGCAGCCA
CAATTTGGCTGCA
CACCTCGGCATCG
CCGAGCGCCATCA
CAAGAGGCTATCA
CCGACCGCCATCA
CACCTGGCCGGCA
CAGCTTGCCGCCG
CACAGCGCCATCA
GCCATCGCCACCA
CAGCTTGCCGTCG
CCAAGCGCCATCA
CACTTCGGCGTCA
CAATCGGCCAGCA
CGGCTTGCCGCCA
CAGCTCGACAGCG
CCATGCGCCATCA
CAAAGCGTCATCG
CAGCACGCGATCA
CTGGTTGCCAGCG
CAGCGCGCCAGCA
CGAATCGGCGTCA
TTCATCGCCAGCA
CAGATCGCCACCA
CAGGTAGCCATCG
CGCATCGCTATCG
CGAAAGGCCGCCA
TTCATCGCCATCA
TACATCGCCTTCA
CAAATTGCTGCCG
GGAATTGGCATCA
TCGATGGCCACCA
CGGAAGGCTATCG
CCCATTGGCATCA
CTGAAGGCCAGCA
CATGGCGCCACCA
CCAGTCGCCATCG
CAGTTGGCGACCA
CAAACGGCCAGTA
CAGAGTGACACCA
GAAAACGACATCA
CAGAATGGCAGCA
CAGAATGCTATCG
CAGATCGGCATCA
CGCATGGCCAGCA
CACATGGCCTTCG
CAAGTGGCGATCA
CAGCGCGCCAGCA
CAATACGCCACCA
TACATGGCCATCG
CTGCAGGCCAGCA
TGCACCGCCATCA
CCCAGGGCCAGCA
ATCATCGCCATCA
CCCATCGCCGGCA
CACCATGCCATCT
CGCTTCGCCAGCA
CGGATTGGCATCC
CAGGACGCCACCA
CGAATAGCTAGCA
CAGAACGCCAGCC
CCACTCGCCAGCA
CAAAACGCCATTA
CCGCGCGCCAGCA
CCATTTGCCGTCC
TCAAACGCCATCG
CAGATCGCCACGC
CGGATCGCCGCCG
CGATTCGCCATCC
GCGATTGCCAGCG
CGTATCGCCATCA
CCATATGCCATCA
CCTATTGCCGGCA
GAGTTCGGCATCA
CGCATCACCATCA
CTTCTTGCCATCG
TTGAGCGCCATCA
CATAACGCCATCG
CACCGCGCCATTA
CTATTGGCCAGCC
CACAGTGCCATCA
CAGATGGCCATCA
CAGGTTGCCGGCG
CCAATGGCCACTA
GGAAAGGCCATCA
CAAGTTGGTATCA
CCGTTTGATATCA
CGACAGGCTATCA
CACGTTGCCAGCT
CCAACTGCCATCG
CATATCGCCAGCC
CAGCTGGCGATCA
CGTTTTGCCAGTA
CAAAACGCCGGCA
GCCATGGCCACCA
CAGAGTGCCGTGA
CCGATCGCCAGCA
CCGTTTGCCGTCG
CGCACCGCCAGCG
CGCTACGCCATCG
CGCTACGCCATCG
CAGATCGCCGGCT
CAGAAGGCCATGG
CTGTTCGCCAGCG
CTGCACGCCAGCA
CGGCAGGCCACCA
CTGAACGCCAGCA
CAGAACGCCACCG
CAGTTCGCCGCCG
CAGAGCGACAGCA
CCAAGGGCCAGCA
CAAGACGCCGCCA
CGCTGCGCCATCA
CCGGGTGCCATCG
CAGGTGGACATCA
CAGGCGGCCACCA
CGCTTGGCCACCA
CATTCCGCCATCG
TCGAAGGCCAGCA
CACTACGCCAGTA
CAGCAGGCCATCG
CAGAGTGCCAGGG
CGCTTCGCCGGCA
CAGCTTGCCGGCG
GCCTTGGCCATCA
CCGATGGCCAGCA
CAGTTCGCCACCC
CGGTCGGCCATCG
CAGCAGGCCATCG
CGACGGGCCACCA
CAAAGTGCGATCA
CACTTTGCGATCA
CAGATCGCCGCCA
CAGTTCGCCACGG
TCCATCGCCACCA
CCGTAGGCCAGCA
CATTATGACATCA
CGGTAGGCCAGCA
CAGAAGGCCAGCG
CCCGAGGCCAGCA
CGCCTCGCCAGCC
GACCTCGCCATCG
CGCTTCGCCACCG
GGGTAGGCCATCA
CAGGTGGCGATCA
CAGATCGCCGTCA
CCGAACGCCAGCG
CAGCTTGCCGGCG
TCCTTCGCCAGCA
CACATTGACATTG
CAGTAGGCCATCA
CGAAACGCCACCT
CGCAGCGCCAGCG
CGGAAGGCCATAA
CACTGTGCTATCG
CAGAGCGCCATCA
CCGAAGGCCAGGA
CAGCATGCCGCCA
CAGGGCGCCAGCG
CAACTGGCCAGCC
CAGTCCGCCACCG
CGAAACGCCAGCG
CGTTTCGGCAGCA
CAAAAAGCCATCA
CGACTCGGCATCG
CAGAAGGCCATGG
CAGTTCGCCGCCA
CTCCTGGCCATTA
CTGCTCGACATCA
CGGTTTGCCATCG
CTGCTCGCCACCA
CACTTCGGCATCG
GAACATGCCATCC
CCGTTCGCCGCCA
CACAAGGCCATCG
CACAAGGCCATCA
TAATTCGCCAGCA
GCGAGTGCCATCA
CCTTTTGCCTGCA
CCGTGCGCCAGCA
CACATGGCCATCG
CCGATGGCCATGT
CCGACCGCCAGCA
CGGAACGCCAGCA
CCCTTGGCGATCA
CACCCGGCCATCC
CTGTTCGACATCA
CTGAGGGCCATGA
TACAGGGCCAGCA
CAGACGGCCAGCT
CAGTGTGCCAGCA
TACCTGGCCATCA
CAGAATGACATCA
CCGATGGCCAGCT
GAGCTGGCCATCG
TTGATCGCCAGCA
CAGATGGCTGCCA
CCCATCGCCACCA
CAGTTCGTCATCA
ATCATCGCCATCA
CGGATCGCCATCA
CACTGCGCCATAA
CACAACGCCAGCA
CAATAGGCCAGCG
CACTTCGCTATCA
CACGACGCCAGCG
CGTTCGGCCATCA
CCGATGCCCAGCA
CCTCACGCCACCA
CGAATCGGCATCG
CGGATCGCCAGCA
CACAGCGCCAGCG
GGGATTGCCATCG
CAGTGCGCGATCA
CAGTTGGCCAGCA
CACAACGCCGTCG
CCGTTGGCCACCA
CAGATCGCCGTTG
CTGCTCGCCAGCC
GAGACGGCCATCG
CCGATGGCCGTCT
CACATCGCCGCCA
CACAACGACAGCA
CAGATCGCCAGGC
CAACCTGCCATTG
CAATACGCCAGCC
CGGATTGACTTCA
CTGATCGCCATCC
GTGATCGCCATCA
CTGATGGCGATCA
CAGCGCGACATCA
CAGAATGCCTTCA
CGCATCGCCATCA
CAGGTTGCCAGCA
CGAATTGCCATGA
CAATTCGGCATTA
CATTTCGCCAGCA
CCTAGTGCCAGCA
CATAGCGCCAGTA
CGCTACGCCATCT
CGAAGCGCCATGA
CAGATCGCCAGCT
CAGAGTGCCCTCG
CAGATTGCCATCG
AAGAACGCCATCA
CAGAACGCCAGCA
TACATCGCCATGA
CCGTTCGCCACCA
CACTTCGCCCTCA
CTGTTCGCCAGCG
CAACTGGCCTTCC
CAGCATGCCTTCG
CTCTTTGCCATCA
CCCTGGGCCATCG
CAGAACGACAACA
CAAAATGCCACGC
GAGTTCGCCATCA
CAGATCGCCACCT
CACGTGGCCATTA
CAGACAGCCATGA
CTCTTCGCCACCA
CGAGATGCCATGA
CCCTTCGCCATCG
CGCCTGGCCATCG
CAGAACGCCCGCA
CGGCTCGCCAGTA
TACTTCGCCAGCA
CGTTTGGCCATGA
CAAAAAGCCAGCG
TCGAACGCCAGCA
CAGATCACCAGCG
CAGATCGCCACCA
CACATGGGCAACA
CAGCTGGCCATCG
CCGATGGCCAGCT
CCATCGGCCGTCA
CAGATGGCCTACA
CAGCACGACACCA
CAACGTGCCATCA
CAAATCGCTATCT
AAATAGGCCAGCA
TGCCAGTACCAGCT
TGGCAAAACGCCGG
GGCCATCATCCAAC
GTACTGGCAAAACGCCGGCACG
CATTGGCCATTACCAGCCTCCC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AGGTTCATTCGTCGATAGTGGCTT
GCTATCACCTATCGCCATGAAAGC
ATGATGGCTCTATGCTATCACCTA
GTGATAGCATAGAGCCATCATTCG
CTAATGGCAAGGCGCCATTATCTT
ATAATGGCGCCTTGCCATTAGCTT
GTGGTCGCAGAACGCCACCTCTGC
AGGCCAGCCTTTTGCCAGCATCGC
ACGCTCTCGCTTGGCCACCAACTC
TGAAGCGCGGATTGGTATCAATCC
GGGCCACCAGGCTGCCATCCTCCA
CCAGCTCCAGATCGATATCGGCCA
GCGGTGCCAGAAGGCCAGCCAGCT
CTGCCGGCAACTAGCTATCACTTG
GTGATAGCTAGTTGCCGGCAGGGA
GTAACGGCACAAAGCCATGAAAAA
TTGGTTTTATTTCGCCATTAATTT
CCTTTGCCTGCTCGCCATCATTGT
CCGCCATTCATTCGCCATCATCTG
CCGCCAACCGTTCGCCATCCGCGC
GTAATCGCCGATCGCCAGTAGCTT
AGTGCAGCAAATCGCCAGCGCTCA
ATAACATCATATTGCCATTACGCA
AGCTTGCCAATATGCCAACGCCTT
CTGATAGCAGCTTGCCAATATGCC
ATATTGGCAAGCTGCTATCAGCTT
CGACATATCCAGCGCCATCAGTTG
ATCATAGCGAAATGCCATTATGGG
ATAATGGCATTTCGCTATGATTTG
ACGCGATCAAAGCGCTATCATCGG
GGAAAGGCATTATGCTATCGAAAC
AAACGGTCAGGTTGCCATCAGCAC
CAGCGATCAGTGTGCCAGCGTCGT
TTTGTAGCACAGTGCCATTACAAA
TAGGTGGCATCTGGCTATCACCGA
GTTGTTGCAAAACGCCATCATCGG
TGAGCATCAGCTCGCCGCCGTTCT
TTGATGACAAAAGGCCATTATCGA
ATAATGGCCTTTTGTCATCAACCG
ACGACGGCAGTGGGCCACCATTAT
GCCCCGGCAATGCGCCAGCAATCC
TTGACTCTCAATGGCCATCATGAC
CTTCGCGGAACTTGCCATCGCGTA
GCTGGCGCAGTTTCCCATCGAGTT
CTGATTCCAAATAGCCATTAAGCG
CGGCCAGCGAATCGCGATCCGCCT
ATCAAGGCACAGTGCTATCATTGA
ATGATTTCGAAAGGCCACTACCGA
ATAAAGGCACAATGACATCATTGA
TTACCAGCAGTTCGCCGCCATCGT
CAGGTTGACGATCGCCATCACCTG
CGTCAACCTGGTCGCCACCAGTGT
GCTGAGCCTGTTCGCCAGCTACAT
AGTCGATCAGGTGGCCACGATCCA
GGACGCGCCCTTCGCTACCATAGC
GACCTGGCGGATCGCCTCCATCAG
GCTCGAGCAGCATGCCATCGAACT
GGCCCGCCAGTACGGCATCCTGGT
TAGTTAGCTATTCGGCAGCAATAT
TTGGGCACGAATGGCCGGCAGTAT
AGTGCTTCAAATAGCCATCACTTG
CGCAGTCCACTTTGCTATCATTCT
ATTGCCGCAATTGGCCATACCTGC
TTGGTTGCAGTCTGCCGTCAGCAT
CTGACGGCAGACTGCAACCAAGGC
CGCGACACAGAAGGCCAACGAACT
CTGGAAGCACAATGCCACCCCCAG
CGATATCGAGGTTGCCACCATGTT
ATCGATCCAGCACGCCATCGAGGT
GCATGGGCGCTGTGCCATCACAGC
CGTCGTGCTTTCCGCCATCATTCC
AAGCACGACGATGGCCAGCACGTA
GTTCGGTCAGAGTGCCGCCATCTT
GGCCTCGCAAATTGCCATCATTTC
TTGCCATCATTTCGCCACCTTCTT
GAAGACTCAAGTCGCCATCATCGG
TTGGCTGCAATCTGCCATCGCCAA
GCGATGGCAGATTGCAGCCAAATT
CTCCATGCAATTTGGCTGCAATCT
GCGCCATCACCTCGGCATCGCTGT
ATAGAGACCGAGCGCCATCACCTC
TTTACCTCAAGAGGCTATCACGAG
GGCACCGCCGACCGCCATCAGGAG
CGATCAGCACCTGGCCGGCATAAC
TCAGCGCCAGCTTGCCGCCGTCCA
CAGGGTGCACAGCGCCATCAGCTC
CGACGGCGCCATCGCCACCAGCTT
TCGCCACCAGCTTGCCGTCGCGAT
GTAGAGACCAAGCGCCATCACTTC
GCGCCATCACTTCGGCGTCACTGT
ATGCTATCAATCGGCCAGCAAATA
CCCATGCCGGCTTGCCGCCAGAGC
CCAGGGTCAGCTCGACAGCGTCGT
GAGGTGCCCATGCGCCATCAGCAC
CTGCAATCAAAGCGTCATCGTCAC
AGGCGACCAGCACGCGATCACCGG
CGGCCGCCTGGTTGCCAGCGAGCT
GATGAACCAGCGCGCCAGCAGGCT
GGGCTATCGAATCGGCGTCACGGT
CAGCCTGTTCATCGCCAGCAAGGT
CCATAGCCAGATCGCCACCAAGAC
GGGTGGCCAGGTAGCCATCGGTGC
GCCCTGGCGCATCGCTATCGAAGC
AACATCGCGAAAGGCCGCCATTCT
CATCGCCTTCATCGCCATCACCCT
CGGCTCGTACATCGCCTTCATCGC
TTATCGCCAAATTGCTGCCGGAAC
AGACCGGGGAATTGGCATCAGTTC
GGCCCGTTCGATGGCCACCACGAC
ATGGGTCCGGAAGGCTATCGCAAG
CAGATAGCCCATTGGCATCATCCG
ACAATGCCTGAAGGCCAGCATTGA
TCAGTTTCATGGCGCCACCATCCT
CGGCGCTCCAGTCGCCATCGCTGA
GGCGTACCAGTTGGCGACCACCAC
GCGCATTCAAACGGCCAGTAAAGG
CCAGTAGCAGAGTGACACCAATCG
TGGCAACGAAAACGACATCATCAA
GATCAGGCAGAATGGCAGCAACAT
GCGTGGGCAGAATGCTATCGATGC
GGGGATGCAGATCGGCATCAGTCT
CGCCAACCGCATGGCCAGCAATTC
GGGTCAGCACATGGCCTTCGGCCA
GCGCGAGCAAGTGGCGATCATGCC
AATCCCTCAGCGCGCCAGCACTCG
CCGCTCGCAATACGCCACCAGGCG
GCGCTTCTACATGGCCATCGCCCT
GAAATGGCTGCAGGCCAGCAGGGG
GATGTACTGCACCGCCATCATCCA
GCTCTTGCCCAGGGCCAGCATGTC
GTTCATCATCATCGCCATCATCTC
GTCCATACCCATCGCCGGCATCAT
AAGATAGCACCATGCCATCTTTCG
TATGCATCGCTTCGCCAGCATCGC
CAGTTGGCGGATTGGCATCCTAAT
GGTCGGCCAGGACGCCACCAGGCC
GTTCCGGCGAATAGCTAGCAGAAC
GCTGCTGCAGAACGCCAGCCGCGC
GCCTCGGCCACTCGCCAGCAAAAC
TCGCCAGCAAAACGCCATTATTCC
CAGCGGGCCGCGCGCCAGCAACCT
GCGCCTGCCATTTGCCGTCCGCCT
TCGCCCTTCAAACGCCATCGGTTT
TTGCCGGCAGATCGCCACGCTGTT
GGTAGACCGGATCGCCGCCGAGCT
CAAGCATCGATTCGCCATCCTTGT
TGCTTCAGCGATTGCCAGCGGTAC
GCCGAAGCGTATCGCCATCAATGG
CTGCGCGCCATATGCCATCAATGG
TCATTTTCCTATTGCCGGCACTGG
GCGCGACGAGTTCGGCATCAAGCC
GGACCCGCGCATCACCATCATGTC
AGTCCAGCTTCTTGCCATCGCTCT
GCGATGCTTGAGCGCCATCAGCAC
CTGCTGTCATAACGCCATCGTTCA
ACTGGAACACCGCGCCATTACCGG
GTCGTGGCTATTGGCCAGCCTTTC
ACAGTCACACAGTGCCATCAGGAT
TTCAGGCCAGATGGCCATCACCCA
GCAGCGCCAGGTTGCCGGCGTAGT
ATGCCTGCCAATGGCCACTAGTTG
ATTTAACGGAAAGGCCATCAAGTT
AGGCCATCAAGTTGGTATCAAGTG
GAAATATCCGTTTGATATCACTTG
AGGATGTCGACAGGCTATCATGGC
TATCTCGCACGTTGCCAGCTTTTT
GCAGTTGCCAACTGCCATCGGCAC
TGGCGATCATATCGCCAGCCATCC
GGCTGGGCAGCTGGCGATCATATC
GTGCCGGCGTTTTGCCAGTACCAG
GTACTGGCAAAACGCCGGCACGCA
GGCGGACGCCATGGCCACCACCAG
GGCCAGCCAGAGTGCCGTGAAGGC
GGTGAAGCCGATCGCCAGCAGTGC
TTACGCCCCGTTTGCCGTCGGCGC
GAACTGGCGCACCGCCAGCGGCGC
GCGCTATCGCTACGCCATCGACGG
CTGGCGCCGCTACGCCATCGCCGA
CTACGCCCAGATCGCCGGCTTCCC
GTGGTACCAGAAGGCCATGGTGTT
GTTGCTGCTGTTCGCCAGCGGCCT
GGTTGACCTGCACGCCAGCACGCC
GCCGCCGCGGCAGGCCACCACCAG
GATCGGCCTGAACGCCAGCAGCGT
GCTGACGCAGAACGCCACCGGTAG
ACGCGAGCAGTTCGCCGCCGTTGC
GCCGAGGCAGAGCGACAGCAGGCC
CAGCAGGCCAAGGGCCAGCAAGAC
GGGCCAGCAAGACGCCGCCAGCGG
ATGCTGCCGCTGCGCCATCAGCCG
CAACTGGCCGGGTGCCATCGGGCT
CAGGCAGCAGGTGGACATCACCGA
GTAGCCGCAGGCGGCCACCAGCAC
CTTGTGCCGCTTGGCCACCACTGG
TAGAGCCCATTCCGCCATCGAAGG
TCCGCCATCGAAGGCCAGCAACTA
CGGACACCACTACGCCAGTAGTTG
CCTGCACCAGCAGGCCATCGATGC
GGGCGACCAGAGTGCCAGGGTGCC
TATCGAGCGCTTCGCCGGCAAGCT
GCAGCGGCAGCTTGCCGGCGAAGC
GGTGTCTGCCTTGGCCATCAGAGC
GACGACGCCGATGGCCAGCATTAC
CAAGTGCCAGTTCGCCACCCGCGT
CTGACGGCGGTCGGCCATCGTTTA
AGGCATCCAGCAGGCCATCGTCCT
GAGCAGGCGACGGGCCACCAGGGT
CTGATCGCAAAGTGCGATCAGCAG
CTGATCGCACTTTGCGATCAGTCC
CTCGCGGCAGATCGCCGCCAGCCA
CCGCCACCAGTTCGCCACGGGAGC
GTTGTCGTCCATCGCCACCAGATG
CAGCGCTCCGTAGGCCAGCACGAC
GTCGCATCATTATGACATCACGCC
CGGCCAGCGGTAGGCCAGCAGGCC
GGTCAGGCAGAAGGCCAGCGCGGT
GGCGTGGCCCGAGGCCAGCAGCGG
GGAACGTCGCCTCGCCAGCCAAGG
AGCGGCCGACCTCGCCATCGGTAT
GCAGGGGCGCTTCGCCACCGTGAT
GGCATGCGGGTAGGCCATCACGGT
CGGCTACCAGGTGGCGATCACCGC
GCGGCGGCAGATCGCCGTCACTGA
CTTCAGGCCGAACGCCAGCGGCTC
GGTAGACCAGCTTGCCGGCGCCGA
GACCAGTTCCTTCGCCAGCATCCG
GAGCGATCACATTGACATTGATGT
CACCGGACAGTAGGCCATCACCGG
CCGGTGCCGAAACGCCACCTTCGT
ATGGAGTCGCAGCGCCAGCGGGCG
GTGCTATCGGAAGGCCATAAAAAC
CTGAAATCACTGTGCTATCGGAAG
GTGCGGCCAGAGCGCCATCACCAG
CAGCAGGCCGAAGGCCAGGACCGC
GGACGAGCAGCATGCCGCCAGCGG
GCGCTACCAGGGCGCCAGCGTACT
CGGAGCGCAACTGGCCAGCCTGGT
GTCCTACCAGTCCGCCACCGGAGC
GTGCTGCCGAAACGCCAGCGCGGC
GCGCTGGCGTTTCGGCAGCACGTC
GATGAGTCAAAAAGCCATCACCCG
ACGATACCGACTCGGCATCGCGAG
ATGGCCGCAGAAGGCCATGGTCAG
GCAGCTTCAGTTCGCCGCCATCGG
CATATCTCTCCTGGCCATTATCGT
CGCCAAACTGCTCGACATCACCCT
CGTACACCGGTTTGCCATCGATCT
GACAGGCCTGCTCGCCACCATCGC
GTTCCAGCACTTCGGCATCGAGAC
TGGCGACGAACATGCCATCCACGG
CGGCCACCCGTTCGCCGCCACGGG
GTCGCTGCACAAGGCCATCGACCT
CGTGTACCACAAGGCCATCAATTG
CTGACGCTAATTCGCCAGCACTGC
TCCTGTGGCGAGTGCCATCATTTC
CAACTGGCCTTTTGCCTGCAACCG
GTGCTGACCGTGCGCCAGCAACTG
CGGTCAGCACATGGCCATCGGCGT
GCGGACGCCGATGGCCATGTGCTG
CATCAGGCCGACCGCCAGCATCAT
CAGCCAGCGGAACGCCAGCAGGGT
CCAGGCACCCTTGGCGATCAGTGG
TGGCCAGCACCCGGCCATCCTTGA
CGTGACCCTGTTCGACATCATGGG
CGATGCCCTGAGGGCCATGACGTG
ATGCTTGTACAGGGCCAGCACGGC
ATCGCGCCAGACGGCCAGCTTGTA
AAACAGCCAGTGTGCCAGCACCTT
GCGCGGCTACCTGGCCATCACCTT
CGAACAGCAGAATGACATCATCCG
TTCGCTACCGATGGCCAGCTCCAG
GGAACTGGAGCTGGCCATCGGTAG
GGCGACATTGATCGCCAGCACCAG
GTGCGCGCAGATGGCTGCCATCCA
CTGCACGCCCATCGCCACCAGCAG
GGGCGTGCAGTTCGTCATCAACGG
GATCGCCATCATCGCCATCAGCAC
GATGCCGCGGATCGCCATCATCGC
CACCGAGCACTGCGCCATAAAGGT
GTAGCGCCACAACGCCAGCACCAC
CTCGCTGCAATAGGCCAGCGGCCG
CCCCCCTCACTTCGCTATCACTGA
GCCGGACCACGACGCCAGCGAATG
GGTGGGGCGTTCGGCCATCAATAC
GCCACCACCGATGCCCAGCATGTC
ATGAAGCCCTCACGCCACCACCGA
GTGCCAGCGAATCGGCATCGGCCA
GTAGCGGCGGATCGCCAGCAACCC
CATGCAGCACAGCGCCAGCGGCGA
CGGGGGCGGGATTGCCATCGGCGG
CACTCCACAGTGCGCGATCATTTC
ACGCAGCCAGTTGGCCAGCAGTTG
CAACGGGCACAACGCCGTCGAGGC
CAGATCGCCGTTGGCCACCAGGAA
TGGCGAGCAGATCGCCGTTGGCCA
CGGCGATCTGCTCGCCAGCCTCCC
GAAGATCGAGACGGCCATCGGCCT
GGACAGGCCGATGGCCGTCTCGAT
ATGGCTGCACATCGCCGCCAGGGT
GACCTGGCACAACGACAGCATGGG
ACCGTGCCAGATCGCCAGGCTGTA
ACGGTTTCAACCTGCCATTGCTGA
TTGACTTCAATACGCCAGCCCTGC
TCCCGAGCGGATTGACTTCAATAC
CACCAACCTGATCGCCATCCTGCT
CAGGTTGGTGATCGCCATCAGGCC
GATGGGCCTGATGGCGATCACCAA
GGCCTATCAGCGCGACATCAAGCT
GCCCACGCAGAATGCCTTCATCGA
TTGGCCGCGCATCGCCATCAATGG
GCGGTACCAGGTTGCCAGCAGCGT
CTAATGCCGAATTGCCATGACCGA
GTCATGGCAATTCGGCATTAGTTG
GCCTGGCCATTTCGCCAGCATCGC
ATAGAGGCCTAGTGCCAGCAGAAA
ATGGCGTCATAGCGCCAGTAGGAC
GCGCTATCGCTACGCCATCTACAA
ATCTGGGCGAAGCGCCATGAAGGC
CTTCGCCCAGATCGCCAGCTCCTC
CCAGAACCAGAGTGCCCTCGGCAT
TCTGTACCAGATTGCCATCGATCA
GGCCTACAAGAACGCCATCATGGC
GAAGGTGCAGAACGCCAGCAGGTA
TTGGATGTACATCGCCATGATGGG
CGAAGTGCCGTTCGCCACCATCCT
TTCTAAACACTTCGCCCTCAGGCG
CCTCTGGCTGTTCGCCAGCGGACG
GGCTTGCCAACTGGCCTTCCTCTG
CGTAGGCCAGCATGCCTTCGTCGG
AAGCTGTCTCTTTGCCATCATCCA
CCTCGTCCCCTGGGCCATCGAGCC
AGCCCATCAGAACGACAACACCGG
TCATACGCAAAATGCCACGCATCG
CACCGCCGAGTTCGCCATCAACAT
GAGCAAGCAGATCGCCACCTCCGA
GCCACGCCACGTGGCCATTATCAT
CCGGCCTCAGACAGCCATGAGGTC
GCGCGACCTCTTCGCCACCATCAA
TTCATCACGAGATGCCATGAATTT
CCTGCTGCCCTTCGCCATCGTGCT
GATAGATCGCCTGGCCATCGCGGA
CGGCGGGCAGAACGCCCGCAGTCT
TACGTGCCGGCTCGCCAGTACTAT
CAGCGGCTACTTCGCCAGCATCCG
CAAGTGGCGTTTGGCCATGATGCG
ATCATCGCAAAAAGCCAGCGGCAA
ACCGTATTCGAACGCCAGCACGGC
GGCTTCCCAGATCACCAGCGAGTT
CATGCCCCAGATCGCCACCACCGC
CGGTTCGCACATGGGCAACAAGAA
CGACCTCCAGCTGGCCATCGGCCG
GTGACGGCCGATGGCCAGCTGGAG
CAGCTGGCCATCGGCCGTCACCTC
TTCGTACCAGATGGCCTACACGCT
GCCACTTCAGCACGACACCAACGT
ACGACACCAACGTGCCATCATGCG
TAAGGCGCAAATCGCTATCTTGAA
CGCTGCAAAATAGGCCAGCAGCAA
GCGTTTTGCCAGTACCAGCTATCT
GTACTGGCAAAACGCCGGCACGCA
CTGGGGGTTGGATGATGGCCTTCT
GTACTGGCAAAACGCCGGCACGCA
TCCATTGGCCATTACCAGCCTCCC

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_002516.2 G3XCY4 not specified GCCACTATCGACGAA +[2453523:2453537] Experimental technique details ELISA (ECO:0005581) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) pslA (PA2231) , pslB (PA2232) , pslC (PA2233) , pslD (PA2234) , pslE (PA2235) , pslF (PA2236) , pslG (PA2237) , pslH (PA2238) , pslI (PA2239) , pslJ (PA2240) , pslK (PA2241) , PA2230 , PA2229
    ... ... pslA pslB pslC pslD pslE pslF pslG pslH pslI pslJ pslK PA2230 PA2229
    238 23354748
    NC_002516.2 G3XCY4 not specified CCTATCGCCATGA -[5436002:5436014] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) PA4842 , PA4841 , PA4843 , PA4844
    ... ... PA4842 PA4841 PA4843 PA4844
    631 24603766
    NC_002516.2 G3XCY4 not specified CTCTATGCTATCA -[5436015:5436027] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) PA4842 , PA4841 , PA4843 , PA4844
    ... ... PA4842 PA4841 PA4843 PA4844
    631 24603766
    NC_002516.2 G3XCY4 not specified CATAGAGCCATCA +[5436021:5436033] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) PA4842 , PA4841 , PA4843 , PA4844
    ... ... PA4842 PA4841 PA4843 PA4844
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAGGCGCCATTA -[3219562:3219574] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2867 , PA2868 , PA2869 , PA2870
    ... ... PA2867 PA2868 PA2869 PA2870
    631 24603766
    NC_002516.2 G3XCY4 not specified CGCCTTGCCATTA +[3219568:3219580] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2867 , PA2868 , PA2869 , PA2870
    ... ... PA2867 PA2868 PA2869 PA2870
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGAACGCCACCT -[4133888:4133900] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3691 , lptF (PA3692)
    ... ... PA3691 lptF
    631 24603766
    NC_002516.2 G3XCY4 not specified CCTTTTGCCAGCA +[5787668:5787680] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA5138 , PA5137
    ... ... PA5138 PA5137
    631 24603766
    NC_002516.2 G3XCY4 not specified CGCTTGGCCACCA +[3623403:3623415] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3235 , PA3234 , PA3233 , PA3232 , PA3231
    ... ... PA3235 PA3234 PA3233 PA3232 PA3231
    631 24603766
    NC_002516.2 G3XCY4 not specified CGGATTGGTATCA +[3623429:3623441] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3235 , PA3234 , PA3233 , PA3232 , PA3231
    ... ... PA3235 PA3234 PA3233 PA3232 PA3231
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGGCTGCCATCC +[4729255:4729267] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4222 , PA4223 , fptA (PA4221) , PA4220
    ... ... PA4222 PA4223 fptA PA4220
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGATCGATATCG +[4729276:4729288] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4222 , PA4223 , fptA (PA4221) , PA4220
    ... ... PA4222 PA4223 fptA PA4220
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGAAGGCCAGCC +[5247560:5247572] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4677 , PA4676
    ... ... PA4677 PA4676
    631 24603766
    NC_002516.2 G3XCY4 not specified CAACTAGCTATCA -[5247585:5247597] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4677 , PA4676
    ... ... PA4677 PA4676
    631 24603766
    NC_002516.2 G3XCY4 not specified CTAGTTGCCGGCA +[5247591:5247603] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4677 , PA4676
    ... ... PA4677 PA4676
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAAAGCCATGA -[1187310:1187322] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) fleQ (PA1097) , fleS (PA1098) , fleR (PA1099)
    ... ... fleQ fleS fleR
    631 24603766
    NC_002516.2 G3XCY4 not specified TATTTCGCCATTA +[196873:196885] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0172 , PA0171 , PA0170 , PA0169
    ... ... PA0172 PA0171 PA0170 PA0169
    631 24603766
    NC_002516.2 G3XCY4 not specified CTGCTCGCCATCA -[196900:196912] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0172 , PA0171 , PA0170 , PA0169
    ... ... PA0172 PA0171 PA0170 PA0169
    631 24603766
    NC_002516.2 G3XCY4 not specified TCATTCGCCATCA -[5816937:5816949] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA5167 , PA5166 , PA5168 , PA5169
    ... ... PA5167 PA5166 PA5168 PA5169
    631 24603766
    NC_002516.2 G3XCY4 not specified CCGTTCGCCATCC +[5816968:5816980] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA5167 , PA5168 , PA5169
    ... ... PA5167 PA5168 PA5169
    631 24603766
    NC_002516.2 G3XCY4 not specified CCGATCGCCAGTA -[1805317:1805329] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1657 , PA1658 , PA1659
    ... ... PA1657 PA1658 PA1659
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAATCGCCAGCG -[40090:40102] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0038
    ... ... PA0038
    631 24603766
    NC_002516.2 G3XCY4 not specified CATATTGCCATTA +[4167577:4167589] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3722
    ... ... PA3722
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATATGCCAACG -[2125837:2125849] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1941
    ... ... PA1941
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCTTGCCAATA -[2125845:2125857] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1941
    ... ... PA1941
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAGCTGCTATCA +[2125851:2125863] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1941
    ... ... PA1941
    631 24603766
    NC_002516.2 G3XCY4 not specified TCCAGCGCCATCA -[4853977:4853989] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4324
    ... ... PA4324
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAAATGCCATTA -[4854008:4854020] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4324
    ... ... PA4324
    631 24603766
    NC_002516.2 G3XCY4 not specified CATTTCGCTATGA +[4854014:4854026] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4324
    ... ... PA4324
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAAGCGCTATCA -[1830778:1830790] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1680 , PA1679 , aroC (PA1681) , PA1682 , PA1683 , PA1684 , masA (PA1685)
    ... ... PA1680 PA1679 aroC PA1682 PA1683 PA1684 masA
    631 24603766
    NC_002516.2 G3XCY4 not specified CATTATGCTATCG -[1028083:1028095] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0938
    ... ... PA0938
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGGTTGCCATCA +[2773470:2773482] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2462 , PA2461
    ... ... PA2462 PA2461
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTGTGCCAGCG +[2776164:2776176] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2462 , PA2461
    ... ... PA2462 PA2461
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAGTGCCATTA -[4831248:4831260] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) pctC (PA4307)
    ... ... pctC
    631 24603766
    NC_002516.2 G3XCY4 not specified CATCTGGCTATCA -[5252612:5252624] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4683 , PA4684 , PA4685 , PA4686 , hitA (PA4687) , hitB (PA4688)
    ... ... PA4683 PA4684 PA4685 PA4686 hitA hitB
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAAACGCCATCA +[4830882:4830894] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) flp (PA4306) , rcpC (PA4305) , rcpA (PA4304) , tadZ (PA4303) , tadA (PA4302) , tadB (PA4301) , tadC (PA4300) , tadD (PA4299) , PA4298 , tadG (PA4297)
    ... ... flp rcpC rcpA tadZ tadA tadB tadC tadD PA4298 tadG
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCTCGCCGCCG -[1165778:1165790] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) flgE (PA1080) , flgD (PA1079)
    ... ... flgE flgD
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAAAGGCCATTA -[5437704:5437716] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4844 , PA4843 , PA4842 , PA4841
    ... ... PA4844 PA4843 PA4842 PA4841
    631 24603766
    NC_002516.2 G3XCY4 not specified CCTTTTGTCATCA +[5437710:5437722] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4844
    ... ... PA4844
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTGGGCCACCA +[4432549:4432561] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3951 , PA3950
    ... ... PA3951 PA3950
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATGCGCCAGCA +[3819899:3819911] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3413 , PA3412 , PA3411 , PA3410 , PA3409 , PA3414
    ... ... PA3413 PA3412 PA3411 PA3410 PA3409 PA3414
    631 24603766
    NC_002516.2 G3XCY4 not specified TCAATGGCCATCA -[1444639:1444651] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1331
    ... ... PA1331
    631 24603766
    NC_002516.2 G3XCY4 not specified GAACTTGCCATCG -[1814425:1814437] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1664 , PA1663 , PA1665 , PA1666 , PA1667 , PA1668 , PA1669 , stp1 (PA1670) , stk1 (PA1671)
    ... ... PA1664 PA1663 PA1665 PA1666 PA1667 PA1668 PA1669 stp1 stk1
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTTTCCCATCG +[1814465:1814477] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1664 , PA1663 , PA1665 , PA1666 , PA1667 , PA1668 , PA1669 , stp1 (PA1670) , stk1 (PA1671)
    ... ... PA1664 PA1663 PA1665 PA1666 PA1667 PA1668 PA1669 stp1 stk1
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAATAGCCATTA +[4514008:4514020] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4033 , PA4032
    ... ... PA4033 PA4032
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAATCGCGATCC -[553117:553129] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0494 , PA0495 , PA0496
    ... ... PA0494 PA0495 PA0496
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAGTGCTATCA +[3763676:3763688] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3353
    ... ... PA3353
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAAAGGCCACTA -[5063828:5063840] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4520
    ... ... PA4520
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAATGACATCA +[2902161:2902173] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2567 , PA2566 , PA2565 , PA2564
    ... ... PA2567 PA2566 PA2565 PA2564
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTTCGCCGCCA -[3806653:3806665] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3401 , PA3400 , PA3399
    ... ... PA3401 PA3400 PA3399
    631 24603766
    NC_002516.2 G3XCY4 not specified ACGATCGCCATCA -[1193029:1193041] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) fliF (PA1101) , fliG (PA1102) , PA1103 , fliI (PA1104) , fliJ (PA1105)
    ... ... fliF fliG PA1103 fliI fliJ
    631 24603766
    NC_002516.2 G3XCY4 not specified CTGGTCGCCACCA +[1193046:1193058] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) fliF (PA1101) , fliG (PA1102) , PA1103 , fliI (PA1104) , fliJ (PA1105)
    ... ... fliF fliG PA1103 fliI fliJ
    631 24603766
    NC_002516.2 G3XCY4 not specified CTGTTCGCCAGCT -[4860843:4860855] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4331 , PA4332 , PA4330 , PA4333
    ... ... PA4331 PA4332 PA4330 PA4333
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGGTGGCCACGA +[3381053:3381065] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3019 , PA3018 , PA3020 , PA3021
    ... ... PA3019 PA3018 PA3020 PA3021
    631 24603766
    NC_002516.2 G3XCY4 not specified CCCTTCGCTACCA -[2122760:2122772] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1939 , PA1940
    ... ... PA1939 PA1940
    631 24603766
    NC_002516.2 G3XCY4 not specified CGGATCGCCTCCA -[1817755:1817767] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1668 , PA1667 , PA1669 , stp1 (PA1670) , stk1 (PA1671)
    ... ... PA1668 PA1667 PA1669 stp1 stk1
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCATGCCATCG +[1817793:1817805] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1668 , PA1669 , PA1667 , stp1 (PA1670) , stk1 (PA1671)
    ... ... PA1668 PA1669 PA1667 stp1 stk1
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTACGGCATCC +[1817826:1817838] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1669 , PA1667 , PA1668 , stp1 (PA1670) , stk1 (PA1671)
    ... ... PA1669 PA1667 PA1668 stp1 stk1
    631 24603766
    NC_002516.2 G3XCY4 not specified CTATTCGGCAGCA +[1883561:1883573] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1738 , PA1739 , PA1740
    ... ... PA1738 PA1739 PA1740
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAATGGCCGGCA +[5207646:5207658] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4639 , PA4638 , mqoB (PA4640)
    ... ... PA4639 PA4638 mqoB
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAATAGCCATCA -[4394417:4394429] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3921
    ... ... PA3921
    631 24603766
    NC_002516.2 G3XCY4 not specified CACTTTGCTATCA -[2510622:2510634] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2282 , PA2281 , PA2283 , PA2284 , PA2285 , PA2286 , PA2287
    ... ... PA2282 PA2281 PA2283 PA2284 PA2285 PA2286 PA2287
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATTGGCCATAC -[3249809:3249821] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2894
    ... ... PA2894
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGTCTGCCGTCA -[3249831:3249843] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2894
    ... ... PA2894
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGACTGCAACCA +[3249837:3249849] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2894
    ... ... PA2894
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGAAGGCCAACG -[1699016:1699028] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) aer (PA1561)
    ... ... aer
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAATGCCACCC +[3712664:3712676] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3311 , PA3310
    ... ... PA3311 PA3310
    631 24603766
    NC_002516.2 G3XCY4 not specified GAGGTTGCCACCA -[759480:759492] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0691 , PA0690
    ... ... PA0691 PA0690
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCACGCCATCG -[1199906:1199918] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1107 , PA1106
    ... ... PA1107 PA1106
    631 24603766
    NC_002516.2 G3XCY4 not specified CGCTGTGCCATCA +[1199966:1199978] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1107
    ... ... PA1107
    631 24603766
    NC_002516.2 G3XCY4 not specified CTTTCCGCCATCA -[5594308:5594320] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4981 , PA4980 , PA4979 , PA4978 , aruI (PA4977) , aruH (PA4976) , PA4975
    ... ... PA4981 PA4980 PA4979 PA4978 aruI aruH PA4975
    631 24603766
    NC_002516.2 G3XCY4 not specified ACGATGGCCAGCA +[5594325:5594337] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4981 , PA4980 , PA4979 , PA4978 , aruI (PA4977) , aruH (PA4976) , PA4975
    ... ... PA4981 PA4980 PA4979 PA4978 aruI aruH PA4975
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGAGTGCCGCCA +[5029018:5029030] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) roxR (PA4493) , roxS (PA4494) , PA4495
    ... ... roxR roxS PA4495
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAATTGCCATCA +[5531024:5531036] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4929 , PA4928
    ... ... PA4929 PA4928
    631 24603766
    NC_002516.2 G3XCY4 not specified CATTTCGCCACCT +[5531035:5531047] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4929 , PA4928
    ... ... PA4929 PA4928
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAGTCGCCATCA -[280736:280748] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) pobA (PA0247) , PA0246 , aroQ2 (PA0245) , PA0244 , PA0248
    ... ... pobA PA0246 aroQ2 PA0244 PA0248
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATCTGCCATCG -[3674438:3674450] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) oprO (PA3280)
    ... ... oprO
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGATTGCAGCCA +[3674444:3674456] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) oprO (PA3280)
    ... ... oprO
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATTTGGCTGCA -[3674449:3674461] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) oprO (PA3280)
    ... ... oprO
    631 24603766
    NC_002516.2 G3XCY4 not specified CACCTCGGCATCG -[59579:59591] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) exoT (PA0044) , PA0043 , PA0045 , PA0046
    ... ... exoT PA0043 PA0045 PA0046
    631 24603766
    NC_002516.2 G3XCY4 not specified CCGAGCGCCATCA -[59590:59602] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) exoT (PA0044) , PA0043 , PA0045 , PA0046
    ... ... exoT PA0043 PA0045 PA0046
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAGAGGCTATCA -[4894384:4894396] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) bifA (PA4367)
    ... ... bifA
    631 24603766
    NC_002516.2 G3XCY4 not specified CCGACCGCCATCA +[4824985:4824997] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) tadC (PA4300) , tadG (PA4297) , tadD (PA4299) , PA4298
    ... ... tadC tadG tadD PA4298
    631 24603766
    NC_002516.2 G3XCY4 not specified CACCTGGCCGGCA +[4921823:4921835] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4392 , PA4391 , PA4390 , ampG (PA4393)
    ... ... PA4392 PA4391 PA4390 ampG
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCTTGCCGCCG +[4921853:4921865] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4392 , PA4391 , PA4390 , ampG (PA4393)
    ... ... PA4392 PA4391 PA4390 ampG
    631 24603766
    NC_002516.2 G3XCY4 not specified CACAGCGCCATCA -[853718:853730] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) putP (PA0783) , putA (PA0782) , PA0781
    ... ... putP putA PA0781
    631 24603766
    NC_002516.2 G3XCY4 not specified GCCATCGCCACCA +[3402740:3402752] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3039 , PA3040 , PA3041 , PA3042 , PA3043
    ... ... PA3039 PA3040 PA3041 PA3042 PA3043
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCTTGCCGTCG +[3402751:3402763] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3039 , PA3040 , PA3041 , PA3042 , PA3043
    ... ... PA3039 PA3040 PA3041 PA3042 PA3043
    631 24603766
    NC_002516.2 G3XCY4 not specified CCAAGCGCCATCA +[4303693:4303705] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) exoS (PA3841) , PA3842 , PA3843
    ... ... exoS PA3842 PA3843
    631 24603766
    NC_002516.2 G3XCY4 not specified CACTTCGGCGTCA +[4303704:4303716] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) exoS (PA3841) , PA3842 , PA3843
    ... ... exoS PA3842 PA3843
    631 24603766
    NC_002516.2 G3XCY4 not specified CAATCGGCCAGCA +[284110:284122] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0252
    ... ... PA0252
    631 24603766
    NC_002516.2 G3XCY4 not specified CGGCTTGCCGCCA +[2669354:2669366] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) pvdJ (PA2400) , pvdD (PA2399)
    ... ... pvdJ pvdD
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCTCGACAGCG -[1865825:1865837] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) pscL (PA1725)
    ... ... pscL
    631 24603766
    NC_002516.2 G3XCY4 not specified CCATGCGCCATCA -[1600751:1600763] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1473 , PA1474 , PA1472 , PA1471 , ccmA (PA1475) , ccmB (PA1476) , ccmC (PA1477) , PA1478 , ccmE (PA1479) , ccmF (PA1480) , ccmG (PA1481) , ccmH (PA1482) , cycH (PA1483)
    ... ... PA1473 PA1474 PA1472 PA1471 ccmA ccmB ccmC PA1478 ccmE ccmF ccmG ccmH cycH
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAAGCGTCATCG -[2035984:2035996] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA1873 , PA1872 , PA1874 , PA1875 , PA1876 , PA1877
    ... ... PA1873 PA1872 PA1874 PA1875 PA1876 PA1877
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCACGCGATCA -[381723:381735] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0338
    ... ... PA0338
    631 24603766
    NC_002516.2 G3XCY4 not specified CTGGTTGCCAGCG +[381751:381763] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0338
    ... ... PA0338
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGCGCGCCAGCA -[39511:39523] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) trpI (PA0037) , trpB (PA0036) , trpA (PA0035) , PA0038
    ... ... trpI trpB trpA PA0038
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAATCGGCGTCA -[3604631:3604643] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA3215 , PA3216
    ... ... PA3215 PA3216
    631 24603766
    NC_002516.2 G3XCY4 not specified TTCATCGCCAGCA -[5165670:5165682] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA4606 , PA4605 , PA4604 , PA4603
    ... ... PA4606 PA4605 PA4604 PA4603
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGATCGCCACCA -[2784727:2784739] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) foxA (PA2466) , PA2465 , PA2464
    ... ... foxA PA2465 PA2464
    631 24603766
    NC_002516.2 G3XCY4 not specified CAGGTAGCCATCG +[2784752:2784764] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) foxA (PA2466) , PA2465 , PA2464
    ... ... foxA PA2465 PA2464
    631 24603766
    NC_002516.2 G3XCY4 not specified CGCATCGCTATCG -[3351002:3351014] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2992 , PA2993
    ... ... PA2992 PA2993
    631 24603766
    NC_002516.2 G3XCY4 not specified CGAAAGGCCGCCA +[4843573:4843585] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) purU1 (PA4314) , mvaT (PA4315)
    ... ... purU1 mvaT
    631 24603766
    NC_002516.2 G3XCY4 not specified TTCATCGCCATCA -[1161423:1161435] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) braD (PA1073) , braE (PA1072) , braF (PA1071) , braG (PA1070)
    ... ... braD braE braF braG
    631 24603766
    NC_002516.2 G3XCY4 not specified TACATCGCCTTCA -[1161432:1161444] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) braD (PA1073) , braE (PA1072) , braF (PA1071) , braG (PA1070)
    ... ... braD braE braF braG
    631 24603766
    NC_002516.2 G3XCY4 not specified CAAATTGCTGCCG +[2762564:2762576] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA2461 , PA2462
    ... ... PA2461 PA2462
    631 24603766
    NC_002516.2 G3XCY4 not specified GGAATTGGCATCA +[299135:299147] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) PA0264 , PA0263.1 , gabD (PA0265)
    ... ... PA0264 PA0263.1