LuxR - UniProtKB: A7MXJ7 regulon and binding site collection of Vibrio campbellii ATCC BAA-1116


Sites are listed as curated.

TATTGACGACTTTCTCAAC
TTCTGATTTTTTTAGTATT
TATTGAGTATTTTATTAGT
AACTAATAAAATACTCAAT
TATTGTTCAATTGATTAAT
TATTAATCAATTGAACAAT
TATTGATATTTATATCCTT
AATTGATGTATTTGGTTTT
TGGTGATAATTTGCACAGT
AATTGATAAAACTCTTAGA
TATTGATTGTGAACTCAAT
TATTAATCATTGTGTCATT
AATTGTTGCCTCTATCATT
TTTTGATGAGATTATCGAT
TATTGTGATTTTTATAATT
AAGTGACTAAAAAGTCATT
TAATGACTTTTTAGTCACT
TATTGATTTCAATGTCAGG
TAATGACATTTTTATTCAT
TATTGATGGTTATGACTCT
TATTGATTGTATAATCGCC
TATTGATGCATGTGACAAC
TACTGTCAGTTAGCTCAAT
TATTGATAATTCACACCAT
TACTGATGTTTTTATTAAA
AATTGATTCTTTTGTCAGC
TTTTGATTCCTTACTCATT
TACTGATAAATTAGATATT
TATTGACGATTACCTCAGT
TATTGATACTTTTCTCTTG
TATTGATAGAAATGGCTAT
TTGTGACAAGTTAGATATT
TTATGTTTGTTTTATTAAT
TAATGATATTTTAGTCAAA
TTTTGACTAAAATATCATT
TTTTGATAAAAATATATAT
AATTGATTGAATACTCTTT
TTCTGTTATTTTTGTCAAA
TTTTGATTCCTTTCTTATT
TATTGAGAAGAGTCTCAAT
AATTGAGACTCTTCTCAAT
AAGTGATATTTTTCGCAAT
TATCGATTTTGATGTCATC
TATTGATTACACAATCAAC
TATTGATGGTCCTGTCTGT
TAATAATAAGTTTGATAAT
TAATGATATAATTGACGTT
TATTGACTTGTAACTTAAT
TATTGACAGATTTGAAAGT
TTCTGACAAATTTAAAATC
TATTGATAATTCTCTTACC
TATTGATATTTATGACAGA
AATTGATTGTCATGTCACT
TAGTGACATGACAATCAAT
TGTTGTTTACTTTATCGGT
AATTGATACATGCGTCAGT
TATTGATATAACTAACATT
TATTCATAATTCTATTTGT
TATAGACTATATTGAAAGT
TATTGATGAGTTTGTTTTT
TGTTGATAAGTAAATTACT
TATTGCTTCATCTCTCATT
TATTGATAGTTAAGTTACT
AATAGATAACATTAAAAGT
TATTAACATTTTTATAAAG
TCTTTATAAAAATGTTAAT
TATTTATATTTTTATAGTT
TAGTAAGATTTTTATTGGT
TATTGCGATTTTTGATACC
TGTTGATAGGATAATCAGT
TATTGATATAACGATAATT
TATAAAGTTTTTTGTTATT
TACTGTGATCATTCTCAAT
AATTGAGAATGATCACAGT
ATTTGATAATTTTAATAAT
AGTTGTTAAAATAGTCATT
TAATGACTATTTTAACAAC
TATTGATTTCATAATTATG
AATTGAGTTTGTTGTTAAT
TATTTACAGTTTTGTATTT
TATTAATAAAATTATTAGT
AACTAATAATTTTATTAAT
TGTCGATTGTATTATTAGT
TTTTGATATATTTAAAAGC
TATTGTTGTTTTTCATAAT
TATAGATTTTACAGTTACT
AACTAATTCATTTATTATT
TGTTGATACCGTTATCATC
AATAGATATTTTTAACGGC
TATAAATAATTCTATAAAT
TAGTATCAATTTAATCAAT
TATTGATTAAATTGATACT
TATTATCAATTATCTTTGT
AATTGATAATATCGTTAAT
TACTGATACATGACTCAGC
TGCTGACCTATTTCTCATT
TACAGTTAGAATTGTTACT
TATTGTGGATATAATCATT
TAGTAACATGTATGTCAAT
AATTGACATACATGTTACT
TAATTTTAGTTTTGTCACT
AAGTGACAAAACTAAAATT
TTTTGATAGTTTTAACAAT
AATTGTTAAAACTATCAAA
AATCGATAATTAGCTCAAC
TATTGTTATCTGTATCATA
TATTGATGCCTTTATTAAT
TATTAACTTCTTTGTTATT
TCCTGATTTAATTATCAAT
AATTGATAATTAAATCAGG
TATTAACAAGTTTATAAAA
TATTGAGCACTTTGTAATT
TATTGATATTTACATTACT
TATTGCTAAAGTTGTCATT
TAATGACAACTTTAGCAAT
TAGAGTTATTATTCTTATT
TATTATTCTTATTGATAAT
TATTGATAATTATGACTAG
TACTGTGTATTTAGACAGT
TATCGATAGAACTAACAGT
AACTGTTAGTTCTATCGAT
CTTTGATATTTCAGTCAGT
AATTATTAAATCAATCAAT
AATTGATTGATTTAATAAT
TATCGATTACTCTCTCAGC
TAATGATAATTTCATAATT
AATAGATAGCAATCACATT
TGTTGATAGTACTGATAGC
TATTTTTATAAGTGTTATT
AAGTGATGACTTTATTAAT
TATTGATGATTTACTAATT
TATTATCGATTAAGTCATT
TATTGTCGTGATAATTAGT
TATTCATGATTCTATAATT
TAATGACAGTATTGTCGTT
TATTGATAAATATGATATT
TATAGATTATTTACACTTT
TATTTACACTTTAATTAAC
ATGTGACATTTTTGTTAAT
AATTTAGAGTTTTCTTATT
AATAAATGTTTTTGTTACT
TATTGATATATTCATAAAT
TATTTATGAATATATCAAT
AATTGTTTTTATGGAAATT
TATTACTACTTTTATTATT
TATTATTTACTTTCACAGT
TTTAGATAGGTTTGTTAAT
TATTGATTCTTTTGTTTTT
TATTGTTGTTATTATCTTT
TAATGTCTTTATTATCATT
TAATGATAATAAAGACATT
TATTGTTTTTATAAAATTT
TATCGTCAATATTGTAATA
TATTGAGTAATCTCACTTT
TACTGTTATTTTTGACATT
AATTGACTTTAATGTCATT
TAATGACATTAAAGTCAAT
CATTGATATAGTTATTAGT
AACTAACATTGTTGTCAAT
TATTGACAACAATGTTAGT
TTTTGACATTTATATTGAC
TTTTGATTGTTTTATCACT
TATTGACAATTAAATTAAT
AATTAATTTAATTGTCAAT
TATTGATAATAAACAAAGT
TATTGATGCCTTAGTCGAC
TACTGATAGATTAGAAAAC
AATCGATGGTTTTAAAATC
TACTGACGAGTTAATCAGC
TACTGACTTTATTGATATA
AATTGATAGTTTGCTTAAG
TATTGATAATATTGTTGTA
TAATGACACTTTTAATAAC
TAGTGATACTACGGTTAAT
TACTGTCAAATTTATCACT
AAGTGATAAATTTGACAGT
TTGTGACAATTCTGACAAT
AATTGTCAGAATTGTCACA
AACTGATAATCCTATTTTT
TGTTTATAGTTATCTCAGT
TATTGATGTGTAAGACGTT
TTTTATCTAATTTATCATT
ATTTGATGTTTATATCAGT
TAATGACAATAAAAACAAT
TATTGTTTTTATTGTCATT
TGTTGATAGGTTTGATAAT
TATCGTTATTTAACTTAGT
TACTGAGATAAGTATCATT
TAATGATACTTATCTCAGT
TTTTGACACGTTTATCAGA
TATTCTTAATAATGTCATC
TATTGACTGAATGCTCATT
TGTTATCAATTAAGTCATT
TACTGACAAATAACTTTTC
TATTGATTGCTATGTCATT
TATTGTTATTATTGTTATT
TATTGTTATTTAGGACAAA
TCTTTTTAATTCTATCAAT
AATTGATAACTAACATACT
TCGTGATATCTTTATCAGT
TACTGATAGGATTCATAAT
TAGTGATCTATATCTTATT
TTGTGATTTTGTTATTATT
TATAGATAACTTTGTTACC
TATTGTCAGTTTTGTCTTT
TATCGATAAAAATGATATT
TATTGAGTTATTCGTTACT
TATTGATAAGTATGTCTAA
TATTGACAATAAACTAGAT
AATCGATATTCTTGTTAAC
TATTCATAATTTTGTTATA
AACTAATAATTCTGTAAAT
TATTTACAGAATTATTAGT
AACTAACTGTATTATCATT
TATTGATGGAATTAAAAGT
ATTTGATTAATTTGTTACT
TATTGATGAAAATGTAGGT
TTTTGATATTGATGAAAAT
TCTTGATAAGCTTGTCAGT
TATTGAGAACTTTATCTGC
TTTTGATTCTTTTCTCTGC
TATTGTTAGTTCTATTGGT
TGTTGTTTTTATTGTTAGT
ATTTGTTGTTTTTATTGTT
TACTGATAAATCTATTATC
TGTTGATGATTCTATCGTT
TAACGATATTAATGTCAGT
TACTGATATAATTATCGGT
AACCGATAATTATATCAGT
TAGTGTTAACTAACTTAAT
TATCAATTAATTGCTCATT
TATTGACACAGCAATTAAT
TGGTGATAATAGAGTTATT
AATTGATGATGTTATTGAT
TATTGATAGGTTGGTTGTC
TACCGACAATTCACTCAGT
TACTGACACTTTTAATTAT
TATTGATGATTGTGTCCTT
TAGTGATATTTTTGTTACA
AATCGATAAATATATAGTT
TATTGATACCTATAACACT
TAGTGTTATAGGTATCAAT
TATTGATAAGATACTCATC
TATTGAGCAAACTCTTAAT
TATTTATATTTTAGTAAAT
ATTTAATTATTTTGTTGTT
TATTGACCGTTTTATCATT
TAATATTGATATTATTATT
TATTGATATTATTATTGGT
TATTTACAGTTCAGTCAAT
AATTGACTGAACTGTAAAT
TATTGACCAATTAAACAAT
TATTGTTTAATTGGTCAAT
TTTTGATAAATCAGTCATT
TATCAATAAATCTGTTTGT
TTTTGATAACTATAACTTT
TCTTGACAATAAACACAAT
TACTGATTTCAATCTCAAT
TTTTGATGATTAACTTTGT
AATTGATATCTTGCTCAGC
AATTGATAAATTCAATAGC
TAATGACATTACTGTCTAT
TATAGACAGTAATGTCATT
AACTATTAAAATAATCAAT
AATTGATTATTTTAATAGT
TATTGTTGAGACTGTCGAT
TATTGATAATTTTATTTAT
TACTGATAATTTTCTCATT
TACTGTTGTTGTTGTAACT
TGTTGATATTTTAGTCACT
TATCAACTTATCTGTTATT
AATTGATAACTCGGTCAAC
TATTGTTTATTTACTCATC
TTTTGATATTTCTATCACA
TATTGTGATTACGGTTAAT
TATTGATGAATTCATTTAC
AATTTATATTTATAACTAT
TATTGATAGTTATAAATAT
TATTAACGCTTCTATTGAT
TTTTGACTTTTCTATCACC
TATTATCGACTTTATCGAT
TAGTGATCGTTCTCTTATC
TAATGATAGGTTTATAAGT
TTTTGATAAAAAAGTCAGT
TACTGACTTTTTTATCAAA
TATTGATTCATAAGTCAAT
AATTGACTTATGAATCAAT
TATTGTTTTTAATAACAAT
TATTGTTATTAAAAACAAT
TATTGATGTTTCTGTCCAA
TATTGATAGCTCTAACTGT
AATTGATAACTTTGTTTGT
TAGTGATAATAGTCACACT
AAGTGTGACTATTATCACT
TGATGATTTATTTATCACT
AAGTGATAAATAAATCATC
TATTGATAACAATAAAACC
TAATGATAATTTTCATGAT
AATTATTCATTTTATCAAT
AATTGATAAAATGAATAAT
AATTAATAATTCTCATTGT
TATTGATAATAATGTAATC
TATTAATTATTTACACAAC
TAGTGAGAATGTTCACAAT
AATTGTGAACATTCTCACT
AATTGTTTTTTTTGAAAGT
TTTTGTTTTTTTTGTAATT
AATTATTGTTTTTGAAAGT
TATTGATAGGTTTAATAGT
AATTGATAGGATTAACATC
AATTGATAAGTCAATGATT
TAATGATTTTTGTGTAAAT
TATTTACACAAAAATCATT
TATTGTGTCTTGTGTCACT
ATTTAACAGTTTACTCATT
AATTGTTATCATGATTATT
TAGTGAGTGGTTTGTCATT
TATTATCATTTTTGTAAAT
TATTTACAAAAATGATAAT
TATCGTTAGCTTTGTCATA
TACTGATGGTTTTATTTCC
TATTAACGATTTAGTTAGT
TATTGATGTTGCCATCATT
TATTGATGGAACTAATGAT
AATTGATGTTTTTATTATG
AATTCACAAAATTAACAAT
AATTGTTAATTTTGTGAAT
AATTGATGAATTTATTTAT
AATTGTCCATATTGTCACT
TATTGATAATTTACTAGAC
TAGTGTTCATCTTGTCATT
TATTAACTTTTTTGTCAGT
TACTGACAAAAAAGTTAAT
AATAGTCAGTGTTGTCATT
TAGTGTGATATGTATCAAT
TATTGATACATATCACACT
TTTTTACATAATTATCATT
TATTGACAGAAATATCACT
CAGTGATATTTCTGTCAAT
TATTGATAAGGTTATTTTC
TATTGATAAGTTTATGAAT
AATTCATAAACTTATCAAT
AATTGATAACTTTGTAGGT
AAGTGACAAAAAACTCATT
TATTGATGATTATGTAATT
AATTGTTAATTAAATAGAT
TACTGATAAAAAAGAAATC
AAATGATATATTTAACATT
AAATGTTAAATATATCATT
AATTGATGCTTTTGTATTT
TATTGATAACTTTGTTCAA
TATTGTCTAATTTATCGGT
TACCGATAAATTAGACAAT
TTTCGACGATTTTGTTAAT
TATTGTTATTTCTGATGCT
TACTGATAGTTTTGATTTC
TATTGATATTTTTAACTTG
TAGTGATAAAGTAGTCACT
TAATGACAAGTTTAATATT
TATTAATTTCGTTGTTATT
TATTGATGAATTTATAGTT
TATTGTCATTATTGGTGAT
TACTACGAATATTGTCATT
AATTAACAACTTTGATAGC
AATTGAGTATTTTGTTGTG
TATTAATTAAATGCTTAAT
TCTTGTTAGTTTTGAAAGC
TAATGTTAATTCTATAAGT
TGTTGATTAAATTGTCAAA
TAATTATATTTTTATAATT
TAGTGACAATATAGTCATT
AAATGACTATATTGTCACT
TTTTAATATTTATGTCAGT
TGCTGATTTTTTTGGCATT
TATCGCTTTATATATTATT
TATTTATTATTCTATTTCT
TACTGATAACTTTAGTATT
TATTATCAATTAAGTCATT
TATTAACTTATTTATTTGT
TACAAATAAATAAGTTAAT
AACTGATGACTTTGTTCTT
AAGTGTGACTTTTAACATT
TATTGAGGATATTATCAGC
AACTGATTTGATTGTTATT
AATTAATAAAATGGTTAAC
TATCGATAGGTTTATTTTT
AATTGATATTCCAATTATT
TTGTGACAGTTCTATCGTT
TATTGATAATGTAAATTAT
AATTATTGATAATGTAAAT
TACTGTTGAATTTGTGAAC
AATCAACAGAATTGTCATT
TCTTGATCAATTAATCATT
TATTAATAGTAAAGTCTAT
TATAGACTTTACTATTAAT
TATTGAGTCAATAAACAAT
AATAGTTAGTTAAATCAGT
TATTGACTCAATAGTTAGT
AATTGCTATTAGTCTTATT
TATTGTGTTGATTGATATT
ATTTGAGATTGTTGTCATT
AATTTATAAATCTATTTAT
TATAGACCTTTTTAATAAT
TATAAATAGATTTATAAAT
TTTAGATAAATAACTAATT
TATTGACAAAAAACACATC
TTTTGTCAATATAATGAAT
TATTATGGTTTTTGTTTTT
TACTTTTAGAATTGTCAAT
AATTGACAATTCTAAAAGT
TGCTGACTATAAAGTCATT
AACTGACATTTTTGTTTTC
AATTGATGATGTTATTTAT
TATTTATATTTATATCATT
AAATGATATAAATATAAAT
TATAGTTTGATTTATTTAT
TAATGTTATTTGTAACACT
TAGTGTTACAAATAACATT
TAGTGATAATTCAATCATT
AAATGATTGAATTATCACT
TAATGATATTAATAAAATT
TACTGATGCATGTATCGGT
TACTGAGAATTTGATTGCT
CAGAGATACTTTTATCATT
TTCTGATTAATCTGTCGAT
TAGTGATTGCTTTCATGAT
TTTTGATAAGAATGACAAT
TATTGTCATTCTTATCAAA
TACTGACAAAAGCATCATT
AAATGATGCTTTTGTCAGT
AATTGATAGGTTGATCCTT
TCTTGATAGTTTTATAGGT
AATAGATTACTTAGTCACT
TATTAATAGATTACTTAGT
TATTGATAATTTTCATAGA
TATAGATACGTTTGTAAAT
TATTAATATATCTATAACT
TATAGATATATTAATAAGT
AAGTTATAGATATATTAAT
TATAGTTAATTAAATCAAT
AATTGATTTAATTAACTAT
TATTCATGCATTTGTAATT
TTTTGTTAATTTTATTAAC
TATTGTTAGTATTGTTTTT
TTTTAATGTCATTCTCATT
TACTGATAACTTGAACACC
TTTTCATTAATTTATCATC
TATTGAGCATTCTATAAAT
TATTATTAGTTATATTGTT
TACTAATACATTTATCAGA
TTCTGATAAATGTATTAGT
TATTGTTAAAATAATTATT
TTTTGATAGATAAGATTTT
TATTAATAATTTAGAAAGT
TATTGAGTAAATTGACACC
TTTTGATACCTTTATTGCC
TATCGATAAAATTGTCTGC
AATAGATATCGTTGACATT
ACGTGATAGAATTGTAAAT
AATTGATGATAAAATTGTC
TATTAACTTAATTGTAGAT
TATTGATGGTTATGTCTTT
TTCTGATACTTTGCTTAGT
TGTTGATATTTATAGCTTT
TATTGTTTGTTTTGTTTTC
AAGTGAGGTATTTATCAAT
TATTGATAAATACCTCACT
AAATGATCATTTTATAAAT
TTTTGTTATTTATATCATT
AGGTGATTATTTTGTTATT
TTTTAATATTCTTATCACT
TTTTGTTATTTTAAATTAT
ATTTGTGTTTTTTGTTATT
AACTTATATTTTTGTTATT
TAGTGATTACTTACTTATT
TACTGTTAGTTTGAACGTT
TATTTATCGATTTATCACT
TAGTGATAAATCGATAAAT
TGTTGATATGTCTGACACT
TATTAATAATTTCATCAGG
TCCTGACAACTTTGTCCTT
TACTGACAATTGACATATT
CCTTGATATTTTTGTCTAT
ATTAGATAAATTTGTTAAC
TATTATTAGATTAATAACT
AATTGATGGCTTAGTTATT
TTCTGATAAATGTATTAGTAG
TATTGAGTTCACAATCAATAC
TTCTGATAAATGTATTAGTAG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

GTATTGACGACTTTCTCAACG
TTTCTGATTTTTTTAGTATTT
CTATTGAGTATTTTATTAGTT
AAACTAATAAAATACTCAATA
GTATTGTTCAATTGATTAATA
GTATTAATCAATTGAACAATA
TTATTGATATTTATATCCTTA
AAATTGATGTATTTGGTTTTT
GTGGTGATAATTTGCACAGTT
TAATTGATAAAACTCTTAGAC
GTATTGATTGTGAACTCAATA
TTATTAATCATTGTGTCATTA
TAATTGTTGCCTCTATCATTT
CTTTTGATGAGATTATCGATA
TTATTGTGATTTTTATAATTT
GAAGTGACTAAAAAGTCATTA
TTAATGACTTTTTAGTCACTT
TTATTGATTTCAATGTCAGGT
GTAATGACATTTTTATTCATA
TTATTGATGGTTATGACTCTG
TTATTGATTGTATAATCGCCG
GTATTGATGCATGTGACAACA
CTACTGTCAGTTAGCTCAATT
CTATTGATAATTCACACCATT
TTACTGATGTTTTTATTAAAC
CAATTGATTCTTTTGTCAGCT
ATTTTGATTCCTTACTCATTT
TTACTGATAAATTAGATATTT
GTATTGACGATTACCTCAGTA
TTATTGATACTTTTCTCTTGC
TTATTGATAGAAATGGCTATT
TTTGTGACAAGTTAGATATTG
TTTATGTTTGTTTTATTAATC
ATAATGATATTTTAGTCAAAA
TTTTTGACTAAAATATCATTA
TTTTTGATAAAAATATATATG
GAATTGATTGAATACTCTTTT
GTTCTGTTATTTTTGTCAAAA
ATTTTGATTCCTTTCTTATTA
GTATTGAGAAGAGTCTCAATT
TAATTGAGACTCTTCTCAATA
TAAGTGATATTTTTCGCAATT
CTATCGATTTTGATGTCATCG
TTATTGATTACACAATCAACG
TTATTGATGGTCCTGTCTGTA
ATAATAATAAGTTTGATAATG
ATAATGATATAATTGACGTTT
TTATTGACTTGTAACTTAATA
TTATTGACAGATTTGAAAGTG
CTTCTGACAAATTTAAAATCA
GTATTGATAATTCTCTTACCG
GTATTGATATTTATGACAGAG
CAATTGATTGTCATGTCACTA
TTAGTGACATGACAATCAATT
TTGTTGTTTACTTTATCGGTA
CAATTGATACATGCGTCAGTG
TTATTGATATAACTAACATTC
TTATTCATAATTCTATTTGTA
CTATAGACTATATTGAAAGTG
CTATTGATGAGTTTGTTTTTA
TTGTTGATAAGTAAATTACTG
CTATTGCTTCATCTCTCATTA
TTATTGATAGTTAAGTTACTG
TAATAGATAACATTAAAAGTA
CTATTAACATTTTTATAAAGA
TTCTTTATAAAAATGTTAATA
CTATTTATATTTTTATAGTTA
CTAGTAAGATTTTTATTGGTT
GTATTGCGATTTTTGATACCT
GTGTTGATAGGATAATCAGTG
TTATTGATATAACGATAATTA
CTATAAAGTTTTTTGTTATTA
ATACTGTGATCATTCTCAATT
TAATTGAGAATGATCACAGTA
CATTTGATAATTTTAATAATG
CAGTTGTTAAAATAGTCATTA
CTAATGACTATTTTAACAACT
ATATTGATTTCATAATTATGA
CAATTGAGTTTGTTGTTAATG
CTATTTACAGTTTTGTATTTT
CTATTAATAAAATTATTAGTT
TAACTAATAATTTTATTAATA
GAACTAATAATACAATCGACA
ATTTTGATATATTTAAAAGCG
TTATTGTTGTTTTTCATAATA
GTATAGATTTTACAGTTACTT
AAACTAATTCATTTATTATTT
TTGTTGATACCGTTATCATCA
GAATAGATATTTTTAACGGCG
TTATAAATAATTCTATAAATT
TTAGTATCAATTTAATCAATA
TTATTGATTAAATTGATACTA
ATATTATCAATTATCTTTGTC
TAATTGATAATATCGTTAATC
ATACTGATACATGACTCAGCC
TTGCTGACCTATTTCTCATTT
CTACAGTTAGAATTGTTACTT
TTATTGTGGATATAATCATTA
CTAGTAACATGTATGTCAATT
TAATTGACATACATGTTACTA
CAAGTGACAAAACTAAAATTA
CAAGTGACAAAACTAAAATTA
ATTTTGATAGTTTTAACAATT
GAATTGTTAAAACTATCAAAA
TAATCGATAATTAGCTCAACT
GTATTGTTATCTGTATCATAT
ATATTGATGCCTTTATTAATC
TTATTAACTTCTTTGTTATTT
TAATTGATAATTAAATCAGGA
TAATTGATAATTAAATCAGGA
TTATTAACAAGTTTATAAAAG
TTATTGAGCACTTTGTAATTG
TTATTGATATTTACATTACTT
TTATTGCTAAAGTTGTCATTA
CTAATGACAACTTTAGCAATA
TTAGAGTTATTATTCTTATTG
TTATTATTCTTATTGATAATT
TTATTGATAATTATGACTAGC
ATACTGTGTATTTAGACAGTT
TTATCGATAGAACTAACAGTT
TAACTGTTAGTTCTATCGATA
TCTTTGATATTTCAGTCAGTT
CAATTATTAAATCAATCAATT
TAATTGATTGATTTAATAATT
TTATCGATTACTCTCTCAGCA
TTAATGATAATTTCATAATTA
AAATAGATAGCAATCACATTA
TTGTTGATAGTACTGATAGCC
CCAATAACACTTATAAAAATA
AAAGTGATGACTTTATTAATT
TTATTGATGATTTACTAATTT
TTATTATCGATTAAGTCATTG
TTATTGTCGTGATAATTAGTA
TTATTCATGATTCTATAATTT
TTAATGACAGTATTGTCGTTT
CTATTGATAAATATGATATTC
ATATAGATTATTTACACTTTA
TTATTTACACTTTAATTAACA
GATGTGACATTTTTGTTAATT
TAATTTAGAGTTTTCTTATTT
TAATAAATGTTTTTGTTACTT
TTATTGATATATTCATAAATA
TTATTTATGAATATATCAATA
TAATTGTTTTTATGGAAATTA
TTATTACTACTTTTATTATTT
TTATTATTTACTTTCACAGTA
TTTTAGATAGGTTTGTTAATA
TTATTGATTCTTTTGTTTTTA
ATATTGTTGTTATTATCTTTA
ATAATGATAATAAAGACATTA
ATAATGATAATAAAGACATTA
TTATTGTTTTTATAAAATTTC
CTATCGTCAATATTGTAATAA
TTATTGAGTAATCTCACTTTA
ATACTGTTATTTTTGACATTA
TAATTGACTTTAATGTCATTA
TTAATGACATTAAAGTCAATT
CCATTGATATAGTTATTAGTG
GAACTAACATTGTTGTCAATA
ATATTGACAACAATGTTAGTT
ATTTTGACATTTATATTGACA
TTTTTGATTGTTTTATCACTG
ATATTGACAATTAAATTAATT
AAATTAATTTAATTGTCAATA
ATATTGATAATAAACAAAGTA
TTATTGATGCCTTAGTCGACA
ATACTGATAGATTAGAAAACC
AAATCGATGGTTTTAAAATCC
TTACTGACGAGTTAATCAGCA
TTACTGACTTTATTGATATAA
TAATTGATAGTTTGCTTAAGC
CTATTGATAATATTGTTGTAC
CTAATGACACTTTTAATAACA
TTAGTGATACTACGGTTAATG
CTACTGTCAAATTTATCACTT
AAAGTGATAAATTTGACAGTA
ATTGTGACAATTCTGACAATT
GAATTGTCAGAATTGTCACAA
TAACTGATAATCCTATTTTTT
CTGTTTATAGTTATCTCAGTG
TTATTGATGTGTAAGACGTTA
TTTTTATCTAATTTATCATTA
GATTTGATGTTTATATCAGTA
CTAATGACAATAAAAACAATA
ATATTGTTTTTATTGTCATTA
ATGTTGATAGGTTTGATAATA
TTATCGTTATTTAACTTAGTC
TTAATGATACTTATCTCAGTA
TTAATGATACTTATCTCAGTA
TTTTTGACACGTTTATCAGAA
TTATTCTTAATAATGTCATCA
ATATTGACTGAATGCTCATTA
TTGTTATCAATTAAGTCATTG
TTACTGACAAATAACTTTTCA
TTATTGATTGCTATGTCATTA
TTATTGTTATTATTGTTATTT
TTATTGTTATTTAGGACAAAG
AGATTGATAGAATTAAAAAGA
TAATTGATAACTAACATACTG
ATCGTGATATCTTTATCAGTT
ATACTGATAGGATTCATAATT
TTAGTGATCTATATCTTATTT
TTTGTGATTTTGTTATTATTA
TTATAGATAACTTTGTTACCT
TTATTGTCAGTTTTGTCTTTA
TTATCGATAAAAATGATATTA
TTATTGAGTTATTCGTTACTT
TTATTGATAAGTATGTCTAAC
CTATTGACAATAAACTAGATG
CAATCGATATTCTTGTTAACA
CTATTCATAATTTTGTTATAA
AAACTAATAATTCTGTAAATA
AAACTAATAATTCTGTAAATA
TAACTAACTGTATTATCATTG
TTATTGATGGAATTAAAAGTT
TATTTGATTAATTTGTTACTA
ATATTGATGAAAATGTAGGTA
CTTTTGATATTGATGAAAATG
TTCTTGATAAGCTTGTCAGTA
CTATTGAGAACTTTATCTGCA
TTTTTGATTCTTTTCTCTGCA
TTATTGTTAGTTCTATTGGTT
TTGTTGTTTTTATTGTTAGTT
AATTTGTTGTTTTTATTGTTA
ATACTGATAAATCTATTATCG
TTGTTGATGATTCTATCGTTC
TTAACGATATTAATGTCAGTG
ATACTGATATAATTATCGGTT
GAACCGATAATTATATCAGTA
TTAGTGTTAACTAACTTAATA
CTATCAATTAATTGCTCATTA
TTATTGACACAGCAATTAATG
GTGGTGATAATAGAGTTATTA
CAATTGATGATGTTATTGATA
TTATTGATAGGTTGGTTGTCT
ATACCGACAATTCACTCAGTA
ATACTGACACTTTTAATTATT
CTATTGATGATTGTGTCCTTA
TTAGTGATATTTTTGTTACAT
TAATCGATAAATATATAGTTA
TTATTGATACCTATAACACTA
TTATTGATACCTATAACACTA
TTATTGATAAGATACTCATCA
ATATTGAGCAAACTCTTAATG
TTATTTATATTTTAGTAAATG
TATTTAATTATTTTGTTGTTA
CTATTGACCGTTTTATCATTC
GTAATATTGATATTATTATTG
ATATTGATATTATTATTGGTG
CTATTTACAGTTCAGTCAATT
TAATTGACTGAACTGTAAATA
TTATTGACCAATTAAACAATA
TTATTGACCAATTAAACAATA
ATTTTGATAAATCAGTCATTG
GTATCAATAAATCTGTTTGTT
ATTTTGATAACTATAACTTTG
TTCTTGACAATAAACACAATT
TTACTGATTTCAATCTCAATC
TTTTTGATGATTAACTTTGTA
GAATTGATATCTTGCTCAGCG
TAATTGATAAATTCAATAGCA
ATAATGACATTACTGTCTATA
TTATAGACAGTAATGTCATTA
CAACTATTAAAATAATCAATT
TAATTGATTATTTTAATAGTT
CTATTGTTGAGACTGTCGATA
CTATTGATAATTTTATTTATC
CTACTGATAATTTTCTCATTC
GTACTGTTGTTGTTGTAACTA
CTGTTGATATTTTAGTCACTG
GTAATAACAGATAAGTTGATA
CAATTGATAACTCGGTCAACT
TTATTGTTTATTTACTCATCA
CTTTTGATATTTCTATCACAG
ACATTAACCGTAATCACAATA
TTATTGATGAATTCATTTACA
TAATTTATATTTATAACTATC
ATATTGATAGTTATAAATATA
CTATTAACGCTTCTATTGATG
GTTTTGACTTTTCTATCACCA
TTATTATCGACTTTATCGATA
TTAGTGATCGTTCTCTTATCT
ATAATGATAGGTTTATAAGTT
TTTTTGATAAAAAAGTCAGTA
TTTTTGATAAAAAAGTCAGTA
TTATTGATTCATAAGTCAATT
TAATTGACTTATGAATCAATA
TTATTGTTATTAAAAACAATA
TTATTGTTATTAAAAACAATA
TTATTGATGTTTCTGTCCAAT
TTATTGATAGCTCTAACTGTA
AAATTGATAACTTTGTTTGTG
TTAGTGATAATAGTCACACTT
TTAGTGATAATAGTCACACTT
TAAGTGATAAATAAATCATCA
TAAGTGATAAATAAATCATCA
TTATTGATAACAATAAAACCC
TTAATGATAATTTTCATGATT
TAATTATTCATTTTATCAATT
AAATTGATAAAATGAATAATT
TAATTAATAATTCTCATTGTT
TTATTGATAATAATGTAATCT
CTATTAATTATTTACACAACA
TTAGTGAGAATGTTCACAATT
GAATTGTGAACATTCTCACTA
TAATTGTTTTTTTTGAAAGTA
ATTTTGTTTTTTTTGTAATTA
TAATTATTGTTTTTGAAAGTA
CTATTGATAGGTTTAATAGTT
AAATTGATAGGATTAACATCG
TAATTGATAAGTCAATGATTA
GTATTTACACAAAAATCATTA
GTATTTACACAAAAATCATTA
AAAGTGACACAAGACACAATA
TATTTAACAGTTTACTCATTT
CAATTGTTATCATGATTATTT
CGAATGACAAACCACTCACTA
CTATTATCATTTTTGTAAATA
CTATTATCATTTTTGTAAATA
CTATCGTTAGCTTTGTCATAA
TTACTGATGGTTTTATTTCCT
ATATTAACGATTTAGTTAGTA
CTATTGATGTTGCCATCATTT
TTATTGATGGAACTAATGATA
TAATTGATGTTTTTATTATGT
TAATTGTTAATTTTGTGAATT
TAATTGTTAATTTTGTGAATT
CAATTGATGAATTTATTTATT
AAATTGTCCATATTGTCACTG
TTATTGATAATTTACTAGACT
GTAGTGTTCATCTTGTCATTT
GTACTGACAAAAAAGTTAATA
GTACTGACAAAAAAGTTAATA
TAATAGTCAGTGTTGTCATTA
ATATTGATACATATCACACTA
ATATTGATACATATCACACTA
AGAATGATAATTATGTAAAAA
GTATTGACAGAAATATCACTG
ACAGTGATATTTCTGTCAATA
ATATTGATAAGGTTATTTTCA
GTATTGATAAGTTTATGAATT
GTATTGATAAGTTTATGAATT
AAATTGATAACTTTGTAGGTA
TAAGTGACAAAAAACTCATTG
ATATTGATGATTATGTAATTT
TAATTGTTAATTAAATAGATT
TTACTGATAAAAAAGAAATCT
TAAATGATATATTTAACATTT
CAAATGTTAAATATATCATTT
AAATTGATGCTTTTGTATTTA
TTATTGATAACTTTGTTCAAA
ATACCGATAAATTAGACAATA
ATACCGATAAATTAGACAATA
ATTTCGACGATTTTGTTAATT
TTATTGTTATTTCTGATGCTA
TTACTGATAGTTTTGATTTCA
TTATTGATATTTTTAACTTGA
GTAGTGATAAAGTAGTCACTG
TTAATGACAAGTTTAATATTA
TTAATAACAACGAAATTAATA
TTATTGATGAATTTATAGTTC
ATATTGTCATTATTGGTGATG
ATAATGACAATATTCGTAGTA
TAATTAACAACTTTGATAGCA
TAATTGAGTATTTTGTTGTGA
GTATTAATTAAATGCTTAATG
TTCTTGTTAGTTTTGAAAGCG
TTAATGTTAATTCTATAAGTC
TCTTTGACAATTTAATCAACA
CTAATTATATTTTTATAATTA
TTAGTGACAATATAGTCATTT
TAAATGACTATATTGTCACTA
TTTTTAATATTTATGTCAGTT
ATGCTGATTTTTTTGGCATTA
ATATCGCTTTATATATTATTT
TTATTTATTATTCTATTTCTT
TTACTGATAACTTTAGTATTT
TTATTATCAATTAAGTCATTG
TTATTAACTTATTTATTTGTA
GTACAAATAAATAAGTTAATA
CAACTGATGACTTTGTTCTTA
AAAGTGTGACTTTTAACATTT
ATATTGAGGATATTATCAGCG
TAACTGATTTGATTGTTATTA
CAATTAATAAAATGGTTAACG
TTATCGATAGGTTTATTTTTT
CAATTGATATTCCAATTATTT
GTTGTGACAGTTCTATCGTTA
TTATTGATAATGTAAATTATT
TAATTATTGATAATGTAAATT
TTACTGTTGAATTTGTGAACA
AAATCAACAGAATTGTCATTG
TTCTTGATCAATTAATCATTG
GTATTAATAGTAAAGTCTATA
GTATTAATAGTAAAGTCTATA
CTATTGAGTCAATAAACAATC
CAATAGTTAGTTAAATCAGTC
TTATTGACTCAATAGTTAGTT
CAATTGCTATTAGTCTTATTT
TTATTGTGTTGATTGATATTA
TATTTGAGATTGTTGTCATTA
CAATTTATAAATCTATTTATA
TTATAGACCTTTTTAATAATA
CTATAAATAGATTTATAAATT
GTTTAGATAAATAACTAATTG
ATATTGACAAAAAACACATCG
TTTTTGTCAATATAATGAATT
TTATTATGGTTTTTGTTTTTC
CAATTGACAATTCTAAAAGTA
CAATTGACAATTCTAAAAGTA
TTGCTGACTATAAAGTCATTA
TAACTGACATTTTTGTTTTCA
AAATTGATGATGTTATTTATA
TTATTTATATTTATATCATTT
TAAATGATATAAATATAAATA
TTATAGTTTGATTTATTTATA
TTAATGTTATTTGTAACACTA
ATAGTGTTACAAATAACATTA
ATAGTGATAATTCAATCATTT
AAAATGATTGAATTATCACTA
GTAATGATATTAATAAAATTA
TTACTGATGCATGTATCGGTT
CTACTGAGAATTTGATTGCTT
TCAGAGATACTTTTATCATTT
TTTCTGATTAATCTGTCGATA
GTAGTGATTGCTTTCATGATG
ATTTTGATAAGAATGACAATA
ATTTTGATAAGAATGACAATA
GAAATGATGCTTTTGTCAGTA
GAAATGATGCTTTTGTCAGTA
AAATTGATAGGTTGATCCTTG
TTCTTGATAGTTTTATAGGTG
TAATAGATTACTTAGTCACTT
CTATTAATAGATTACTTAGTC
CTATTGATAATTTTCATAGAA
TTATAGATACGTTTGTAAATA
TTATTAATATATCTATAACTT
TTATAGATATATTAATAAGTT
TAAGTTATAGATATATTAATA
GTATAGTTAATTAAATCAATT
TAATTGATTTAATTAACTATA
CTATTCATGCATTTGTAATTA
TTTTTGTTAATTTTATTAACA
TTATTGTTAGTATTGTTTTTG
GTTTTAATGTCATTCTCATTT
TTACTGATAACTTGAACACCC
ATTTTCATTAATTTATCATCT
CTATTGAGCATTCTATAAATT
CTATTATTAGTTATATTGTTG
CTACTAATACATTTATCAGAA
TTTCTGATAAATGTATTAGTA
TTATTGTTAAAATAATTATTT
TTTTTGATAGATAAGATTTTT
CTATTAATAATTTAGAAAGTA
TTATTGAGTAAATTGACACCT
GTTTTGATACCTTTATTGCCC
TTATCGATAAAATTGTCTGCA
CAATAGATATCGTTGACATTG
AACGTGATAGAATTGTAAATA
TAATTGATGATAAAATTGTCA
ATATTAACTTAATTGTAGATA
TTATTGATGGTTATGTCTTTT
TTTCTGATACTTTGCTTAGTT
TTGTTGATATTTATAGCTTTA
TTATTGTTTGTTTTGTTTTCT
AAAGTGAGGTATTTATCAATA
GTATTGATAAATACCTCACTT
TAAATGATCATTTTATAAATG
ATTTTGTTATTTATATCATTG
AAGGTGATTATTTTGTTATTT
CTTTTAATATTCTTATCACTG
TTTTTGTTATTTTAAATTATT
TATTTGTGTTTTTTGTTATTT
CAACTTATATTTTTGTTATTA
TTAGTGATTACTTACTTATTT
TTACTGTTAGTTTGAACGTTA
TTATTTATCGATTTATCACTA
ATAGTGATAAATCGATAAATA
CTGTTGATATGTCTGACACTG
GTATTAATAATTTCATCAGGC
TTCCTGACAACTTTGTCCTTA
CTACTGACAATTGACATATTT
TCCTTGATATTTTTGTCTATT
TATTAGATAAATTTGTTAACA
TTATTATTAGATTAATAACTA
CAATTGATGGCTTAGTTATTA
CTACTAATACATTTATCAGAA
GTATTGATTGTGAACTCAATA
CTACTAATACATTTATCAGAA

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_009783.1 A7MXJ7 dimer TATTGACGACTTTCTCAAC -[26395:26413] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) aroK (VIBHAR_00028) , VIBHAR_00029 , aroB (VIBHAR_00027) , VIBHAR_00026 , VIBHAR_00025 , VIBHAR_00024
    ... ... aroK VIBHAR_00029 aroB VIBHAR_00026 VIBHAR_00025 VIBHAR_00024
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTCTGATTTTTTTAGTATT +[37372:37390] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00039
    ... ... VIBHAR_00039
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGAGTATTTTATTAGT +[47019:47037] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00045 , VIBHAR_00046
    ... ... VIBHAR_00045 VIBHAR_00046
    604 23839217
    NC_009783.1 A7MXJ7 dimer AACTAATAAAATACTCAAT -[47020:47038] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00045 , VIBHAR_00046
    ... ... VIBHAR_00045 VIBHAR_00046
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGTTCAATTGATTAAT +[52727:52745] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00049 , metL (VIBHAR_00048) , VIBHAR_00050
    ... ... VIBHAR_00049 metL VIBHAR_00050
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTAATCAATTGAACAAT -[52728:52746] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00049 , metL (VIBHAR_00048) , VIBHAR_00050
    ... ... VIBHAR_00049 metL VIBHAR_00050
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATATTTATATCCTT -[84194:84212] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00081
    ... ... VIBHAR_00081
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATGTATTTGGTTTT -[128819:128837] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00130 , VIBHAR_00129 , VIBHAR_00128 , VIBHAR_00131 , VIBHAR_00132 , VIBHAR_00133 , VIBHAR_00134
    ... ... VIBHAR_00130 VIBHAR_00129 VIBHAR_00128 VIBHAR_00131 VIBHAR_00132 VIBHAR_00133 VIBHAR_00134
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGGTGATAATTTGCACAGT -[128953:128971] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00130 , VIBHAR_00131 , VIBHAR_00129 , VIBHAR_00128 , VIBHAR_00132 , VIBHAR_00133 , VIBHAR_00134
    ... ... VIBHAR_00130 VIBHAR_00131 VIBHAR_00129 VIBHAR_00128 VIBHAR_00132 VIBHAR_00133 VIBHAR_00134
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATAAAACTCTTAGA +[159185:159203] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00157 , VIBHAR_00158 , VIBHAR_00159 , VIBHAR_00160 , VIBHAR_00161
    ... ... VIBHAR_00157 VIBHAR_00158 VIBHAR_00159 VIBHAR_00160 VIBHAR_00161
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTGTGAACTCAAT +[178957:178975] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) fis (VIBHAR_00175) , VIBHAR_00176 , VIBHAR_00177 , VIBHAR_00178
    ... ... fis VIBHAR_00176 VIBHAR_00177 VIBHAR_00178
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTAATCATTGTGTCATT +[219915:219933] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00220 , VIBHAR_00221
    ... ... VIBHAR_00220 VIBHAR_00221
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGTTGCCTCTATCATT -[275417:275435] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00284 , VIBHAR_00285 , VIBHAR_00283 , VIBHAR_00286
    ... ... VIBHAR_00284 VIBHAR_00285 VIBHAR_00283 VIBHAR_00286
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGATGAGATTATCGAT -[276214:276232] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00285 , VIBHAR_00284 , VIBHAR_00283 , VIBHAR_00286
    ... ... VIBHAR_00285 VIBHAR_00284 VIBHAR_00283 VIBHAR_00286
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGTGATTTTTATAATT +[286820:286838] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00298 , VIBHAR_00297 , VIBHAR_00296 , VIBHAR_00295
    ... ... VIBHAR_00298 VIBHAR_00297 VIBHAR_00296 VIBHAR_00295
    604 23839217
    NC_009783.1 A7MXJ7 dimer AAGTGACTAAAAAGTCATT +[294759:294777] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00304 , VIBHAR_00305
    ... ... VIBHAR_00304 VIBHAR_00305
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATGACTTTTTAGTCACT -[294760:294778] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00304 , VIBHAR_00305
    ... ... VIBHAR_00304 VIBHAR_00305
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTTCAATGTCAGG +[294987:295005] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00305 , VIBHAR_00306
    ... ... VIBHAR_00305 VIBHAR_00306
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATGACATTTTTATTCAT +[295029:295047] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00305 , VIBHAR_00306
    ... ... VIBHAR_00305 VIBHAR_00306
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATGGTTATGACTCT -[352452:352470] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00364 , thiE (VIBHAR_00365) , VIBHAR_00363 , thiG (VIBHAR_00362) , thiH (VIBHAR_00361)
    ... ... VIBHAR_00364 thiE VIBHAR_00363 thiG thiH
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTGTATAATCGCC +[382973:382991] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00401 , VIBHAR_00402 , VIBHAR_00403 , VIBHAR_00404 , VIBHAR_00405
    ... ... VIBHAR_00401 VIBHAR_00402 VIBHAR_00403 VIBHAR_00404 VIBHAR_00405
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATGCATGTGACAAC +[384034:384052] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00401 , VIBHAR_00402 , VIBHAR_00403 , VIBHAR_00404 , VIBHAR_00405
    ... ... VIBHAR_00401 VIBHAR_00402 VIBHAR_00403 VIBHAR_00404 VIBHAR_00405
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACTGTCAGTTAGCTCAAT +[423387:423405] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00441 , VIBHAR_00440 , VIBHAR_00439 , dnaA (VIBHAR_00442) , VIBHAR_00443 , recF (VIBHAR_00444) , gyrB (VIBHAR_00445)
    ... ... VIBHAR_00441 VIBHAR_00440 VIBHAR_00439 dnaA VIBHAR_00443 recF gyrB
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATAATTCACACCAT -[437929:437947] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00451 , VIBHAR_00452
    ... ... VIBHAR_00451 VIBHAR_00452
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACTGATGTTTTTATTAAA -[463245:463263] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00479 , VIBHAR_00480
    ... ... VIBHAR_00479 VIBHAR_00480
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATTCTTTTGTCAGC -[479896:479914] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00498 , VIBHAR_00499 , VIBHAR_00497
    ... ... VIBHAR_00498 VIBHAR_00499 VIBHAR_00497
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGATTCCTTACTCATT +[482005:482023] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00501 , VIBHAR_00503
    ... ... VIBHAR_00501 VIBHAR_00503
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACTGATAAATTAGATATT +[487214:487232] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00506 , VIBHAR_00505 , VIBHAR_00504 , VIBHAR_00503 , VIBHAR_00507 , VIBHAR_00508
    ... ... VIBHAR_00506 VIBHAR_00505 VIBHAR_00504 VIBHAR_00503 VIBHAR_00507 VIBHAR_00508
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGACGATTACCTCAGT +[506289:506307] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00526 , VIBHAR_00527 , VIBHAR_00528 , VIBHAR_00529
    ... ... VIBHAR_00526 VIBHAR_00527 VIBHAR_00528 VIBHAR_00529
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATACTTTTCTCTTG +[510667:510685] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00529 , VIBHAR_00530
    ... ... VIBHAR_00529 VIBHAR_00530
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATAGAAATGGCTAT +[559570:559588] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00575
    ... ... VIBHAR_00575
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTGTGACAAGTTAGATATT +[678632:678650] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00689 , wecC (VIBHAR_00690) , VIBHAR_00691 , VIBHAR_00692 , VIBHAR_00693 , VIBHAR_00694 , VIBHAR_00695 , VIBHAR_00696 , VIBHAR_00697 , VIBHAR_00698
    ... ... VIBHAR_00689 wecC VIBHAR_00691 VIBHAR_00692 VIBHAR_00693 VIBHAR_00694 VIBHAR_00695 VIBHAR_00696 VIBHAR_00697 VIBHAR_00698
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTATGTTTGTTTTATTAAT +[682506:682524] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00692 , VIBHAR_00693 , VIBHAR_00694 , VIBHAR_00695 , VIBHAR_00696 , VIBHAR_00697 , VIBHAR_00698
    ... ... VIBHAR_00692 VIBHAR_00693 VIBHAR_00694 VIBHAR_00695 VIBHAR_00696 VIBHAR_00697 VIBHAR_00698
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATGATATTTTAGTCAAA +[682591:682609] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00692 , VIBHAR_00693 , VIBHAR_00694 , VIBHAR_00695 , VIBHAR_00696 , VIBHAR_00697 , VIBHAR_00698
    ... ... VIBHAR_00692 VIBHAR_00693 VIBHAR_00694 VIBHAR_00695 VIBHAR_00696 VIBHAR_00697 VIBHAR_00698
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGACTAAAATATCATT -[682592:682610] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00692 , VIBHAR_00693 , VIBHAR_00694 , VIBHAR_00695 , VIBHAR_00696 , VIBHAR_00697 , VIBHAR_00698
    ... ... VIBHAR_00692 VIBHAR_00693 VIBHAR_00694 VIBHAR_00695 VIBHAR_00696 VIBHAR_00697 VIBHAR_00698
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGATAAAAATATATAT +[682699:682717] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00692 , VIBHAR_00693 , VIBHAR_00694 , VIBHAR_00695 , VIBHAR_00696 , VIBHAR_00697 , VIBHAR_00698
    ... ... VIBHAR_00692 VIBHAR_00693 VIBHAR_00694 VIBHAR_00695 VIBHAR_00696 VIBHAR_00697 VIBHAR_00698
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATTGAATACTCTTT -[696285:696303] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00703 , VIBHAR_00704
    ... ... VIBHAR_00703 VIBHAR_00704
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTCTGTTATTTTTGTCAAA +[702404:702422] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) tpiA (VIBHAR_00709) , VIBHAR_00710 , VIBHAR_00711
    ... ... tpiA VIBHAR_00710 VIBHAR_00711
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGATTCCTTTCTTATT -[702517:702535] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) tpiA (VIBHAR_00709) , VIBHAR_00710 , VIBHAR_00711
    ... ... tpiA VIBHAR_00710 VIBHAR_00711
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGAGAAGAGTCTCAAT +[736435:736453] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00756 , VIBHAR_00757 , VIBHAR_00758
    ... ... VIBHAR_00756 VIBHAR_00757 VIBHAR_00758
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGAGACTCTTCTCAAT -[736436:736454] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00756 , VIBHAR_00757 , VIBHAR_00758
    ... ... VIBHAR_00756 VIBHAR_00757 VIBHAR_00758
    604 23839217
    NC_009783.1 A7MXJ7 dimer AAGTGATATTTTTCGCAAT -[762130:762148] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00779 , VIBHAR_00780 , VIBHAR_00781 , VIBHAR_00782 , VIBHAR_00783
    ... ... VIBHAR_00779 VIBHAR_00780 VIBHAR_00781 VIBHAR_00782 VIBHAR_00783
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATCGATTTTGATGTCATC -[762151:762169] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00779 , VIBHAR_00780 , VIBHAR_00781 , VIBHAR_00782 , VIBHAR_00783
    ... ... VIBHAR_00779 VIBHAR_00780 VIBHAR_00781 VIBHAR_00782 VIBHAR_00783
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTACACAATCAAC -[770439:770457] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00786 , VIBHAR_00787 , tbpA (VIBHAR_00788) , thiP (VIBHAR_00789) , VIBHAR_00790
    ... ... VIBHAR_00786 VIBHAR_00787 tbpA thiP VIBHAR_00790
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATGGTCCTGTCTGT +[777145:777163] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00791 , VIBHAR_00792
    ... ... VIBHAR_00791 VIBHAR_00792
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATAATAAGTTTGATAAT +[809353:809371] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) leuO (VIBHAR_00823) , VIBHAR_00824
    ... ... leuO VIBHAR_00824
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATGATATAATTGACGTT +[813996:814014] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) ilvH (VIBHAR_00826) , VIBHAR_00827
    ... ... ilvH VIBHAR_00827
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGACTTGTAACTTAAT +[825599:825617] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00834 , VIBHAR_00833 , mtlR (VIBHAR_00832)
    ... ... VIBHAR_00834 VIBHAR_00833 mtlR
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGACAGATTTGAAAGT -[825629:825647] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00834 , VIBHAR_00833 , mtlR (VIBHAR_00832)
    ... ... VIBHAR_00834 VIBHAR_00833 mtlR
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTCTGACAAATTTAAAATC +[825672:825690] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00834 , VIBHAR_00833 , mtlR (VIBHAR_00832)
    ... ... VIBHAR_00834 VIBHAR_00833 mtlR
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATAATTCTCTTACC +[838177:838195] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00848 , dnaG (VIBHAR_00849) , VIBHAR_00847 , VIBHAR_00846 , VIBHAR_00845 , VIBHAR_00844
    ... ... VIBHAR_00848 dnaG VIBHAR_00847 VIBHAR_00846 VIBHAR_00845 VIBHAR_00844
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATATTTATGACAGA -[846517:846535] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00857 , cca (VIBHAR_00858) , VIBHAR_00859 , VIBHAR_00860
    ... ... VIBHAR_00857 cca VIBHAR_00859 VIBHAR_00860
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATTGTCATGTCACT +[863491:863509] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00870 , VIBHAR_00871 , VIBHAR_00872 , VIBHAR_00873 , VIBHAR_00874 , VIBHAR_00875 , VIBHAR_00876
    ... ... VIBHAR_00870 VIBHAR_00871 VIBHAR_00872 VIBHAR_00873 VIBHAR_00874 VIBHAR_00875 VIBHAR_00876
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAGTGACATGACAATCAAT -[863492:863510] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00870 , VIBHAR_00871 , VIBHAR_00872 , VIBHAR_00873 , VIBHAR_00874 , VIBHAR_00875 , VIBHAR_00876
    ... ... VIBHAR_00870 VIBHAR_00871 VIBHAR_00872 VIBHAR_00873 VIBHAR_00874 VIBHAR_00875 VIBHAR_00876
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGTTGTTTACTTTATCGGT -[865861:865879] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00874 , VIBHAR_00875 , VIBHAR_00876
    ... ... VIBHAR_00874 VIBHAR_00875 VIBHAR_00876
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATACATGCGTCAGT -[1001261:1001279] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_00991 , VIBHAR_00992 , tyrA (VIBHAR_00993)
    ... ... 1000000 VIBHAR_00991 VIBHAR_00992 tyrA
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATATAACTAACATT -[1036969:1036987] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01029 , VIBHAR_01030 , VIBHAR_01031 , VIBHAR_01032 , VIBHAR_01033 , VIBHAR_01034 , VIBHAR_01035 , VIBHAR_01036
    ... ... VIBHAR_01029 VIBHAR_01030 VIBHAR_01031 VIBHAR_01032 VIBHAR_01033 VIBHAR_01034 VIBHAR_01035 VIBHAR_01036
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTCATAATTCTATTTGT -[1048377:1048395] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01039 , VIBHAR_01040 , VIBHAR_01041 , VIBHAR_01042
    ... ... VIBHAR_01039 VIBHAR_01040 VIBHAR_01041 VIBHAR_01042
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATAGACTATATTGAAAGT -[1054031:1054049] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01044 , queA (VIBHAR_01045)
    ... ... VIBHAR_01044 queA
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATGAGTTTGTTTTT +[1054058:1054076] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01044 , queA (VIBHAR_01045)
    ... ... VIBHAR_01044 queA
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGTTGATAAGTAAATTACT +[1126382:1126400] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01112
    ... ... VIBHAR_01112
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGCTTCATCTCTCATT -[1126479:1126497] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01112
    ... ... VIBHAR_01112
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATAGTTAAGTTACT +[1126517:1126535] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01112
    ... ... VIBHAR_01112
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATAGATAACATTAAAAGT -[1148493:1148511] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133
    ... ... VIBHAR_01132 VIBHAR_01133
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTAACATTTTTATAAAG +[1148508:1148526] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133
    ... ... VIBHAR_01132 VIBHAR_01133
    604 23839217
    NC_009783.1 A7MXJ7 dimer TCTTTATAAAAATGTTAAT -[1148509:1148527] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133
    ... ... VIBHAR_01132 VIBHAR_01133
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTTATATTTTTATAGTT -[1148593:1148611] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133
    ... ... VIBHAR_01132 VIBHAR_01133
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAGTAAGATTTTTATTGGT +[1148656:1148674] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133 , dnaK (VIBHAR_01134)
    ... ... VIBHAR_01132 VIBHAR_01133 dnaK
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGCGATTTTTGATACC +[1148725:1148743] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01132 , VIBHAR_01133 , dnaK (VIBHAR_01134)
    ... ... VIBHAR_01132 VIBHAR_01133 dnaK
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGTTGATAGGATAATCAGT +[1156084:1156102] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01138 , VIBHAR_01139 , VIBHAR_01140
    ... ... VIBHAR_01138 VIBHAR_01139 VIBHAR_01140
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATATAACGATAATT +[1197840:1197858] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01178 , VIBHAR_01179 , VIBHAR_01180 , VIBHAR_01181
    ... ... VIBHAR_01178 VIBHAR_01179 VIBHAR_01180 VIBHAR_01181
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATAAAGTTTTTTGTTATT -[1208629:1208647] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01191
    ... ... VIBHAR_01191
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACTGTGATCATTCTCAAT +[1221769:1221787] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) treR (VIBHAR_01204) , VIBHAR_01205 , VIBHAR_01206
    ... ... treR VIBHAR_01205 VIBHAR_01206
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGAGAATGATCACAGT -[1221770:1221788] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) treR (VIBHAR_01204) , VIBHAR_01205 , VIBHAR_01206
    ... ... treR VIBHAR_01205 VIBHAR_01206
    604 23839217
    NC_009783.1 A7MXJ7 dimer ATTTGATAATTTTAATAAT -[1221829:1221847] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) treR (VIBHAR_01204) , VIBHAR_01205 , VIBHAR_01206
    ... ... treR VIBHAR_01205 VIBHAR_01206
    604 23839217
    NC_009783.1 A7MXJ7 dimer AGTTGTTAAAATAGTCATT +[1264285:1264303] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01255 , ushA (VIBHAR_01256) , VIBHAR_01257
    ... ... VIBHAR_01255 ushA VIBHAR_01257
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAATGACTATTTTAACAAC -[1264286:1264304] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01255 , ushA (VIBHAR_01256) , VIBHAR_01257
    ... ... VIBHAR_01255 ushA VIBHAR_01257
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTTCATAATTATG -[1264318:1264336] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01255 , ushA (VIBHAR_01256) , VIBHAR_01257
    ... ... VIBHAR_01255 ushA VIBHAR_01257
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGAGTTTGTTGTTAAT +[1272926:1272944] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01264 , VIBHAR_01265
    ... ... VIBHAR_01264 VIBHAR_01265
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTTACAGTTTTGTATTT +[1285978:1285996] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01273 , VIBHAR_01274
    ... ... VIBHAR_01273 VIBHAR_01274
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTAATAAAATTATTAGT +[1286038:1286056] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01273 , VIBHAR_01274
    ... ... VIBHAR_01273 VIBHAR_01274
    604 23839217
    NC_009783.1 A7MXJ7 dimer AACTAATAATTTTATTAAT -[1286039:1286057] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01273 , VIBHAR_01274
    ... ... VIBHAR_01273 VIBHAR_01274
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGTCGATTGTATTATTAGT +[1329736:1329754] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01320 , VIBHAR_01319 , VIBHAR_01321 , VIBHAR_01322
    ... ... VIBHAR_01320 VIBHAR_01319 VIBHAR_01321 VIBHAR_01322
    604 23839217
    NC_009783.1 A7MXJ7 dimer TTTTGATATATTTAAAAGC +[1336554:1336572] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) adk (VIBHAR_01328) , hemH (VIBHAR_01329)
    ... ... adk hemH
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGTTGTTTTTCATAAT -[1336668:1336686] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) adk (VIBHAR_01328) , hemH (VIBHAR_01329)
    ... ... adk hemH
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATAGATTTTACAGTTACT +[1345952:1345970] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01334 , nagA (VIBHAR_01335) , VIBHAR_01333 , VIBHAR_01336
    ... ... VIBHAR_01334 nagA VIBHAR_01333 VIBHAR_01336
    604 23839217
    NC_009783.1 A7MXJ7 dimer AACTAATTCATTTATTATT -[1346146:1346164] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) nagA (VIBHAR_01335) , VIBHAR_01334 , VIBHAR_01333 , VIBHAR_01336
    ... ... nagA VIBHAR_01334 VIBHAR_01333 VIBHAR_01336
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGTTGATACCGTTATCATC +[1385840:1385858] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01371 , VIBHAR_01372 , VIBHAR_01370
    ... ... VIBHAR_01371 VIBHAR_01372 VIBHAR_01370
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATAGATATTTTTAACGGC +[1386200:1386218] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01371 , VIBHAR_01372 , VIBHAR_01370
    ... ... VIBHAR_01371 VIBHAR_01372 VIBHAR_01370
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATAAATAATTCTATAAAT -[1411214:1411232] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01397 , VIBHAR_01398 , VIBHAR_01399 , VIBHAR_01400 , entF (VIBHAR_01401) , VIBHAR_01402
    ... ... VIBHAR_01397 VIBHAR_01398 VIBHAR_01399 VIBHAR_01400 entF VIBHAR_01402
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAGTATCAATTTAATCAAT +[1464753:1464771] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01446 , VIBHAR_01447
    ... ... VIBHAR_01446 VIBHAR_01447
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGATTAAATTGATACT -[1464754:1464772] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01446 , VIBHAR_01447
    ... ... VIBHAR_01446 VIBHAR_01447
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTATCAATTATCTTTGT -[1498231:1498249] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01493 , VIBHAR_01494 , VIBHAR_01495
    ... ... VIBHAR_01493 VIBHAR_01494 VIBHAR_01495
    604 23839217
    NC_009783.1 A7MXJ7 dimer AATTGATAATATCGTTAAT +[1498239:1498257] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01493 , VIBHAR_01494 , VIBHAR_01495
    ... ... VIBHAR_01493 VIBHAR_01494 VIBHAR_01495
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACTGATACATGACTCAGC +[1585308:1585326] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) glgA (VIBHAR_01576) , VIBHAR_01577
    ... ... glgA VIBHAR_01577
    604 23839217
    NC_009783.1 A7MXJ7 dimer TGCTGACCTATTTCTCATT -[1589551:1589569] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01581
    ... ... VIBHAR_01581
    604 23839217
    NC_009783.1 A7MXJ7 dimer TACAGTTAGAATTGTTACT +[1623181:1623199] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01613 , VIBHAR_01614 , VIBHAR_01615 , VIBHAR_01616 , VIBHAR_01617 , VIBHAR_01618
    ... ... VIBHAR_01613 VIBHAR_01614 VIBHAR_01615 VIBHAR_01616 VIBHAR_01617 VIBHAR_01618
    604 23839217
    NC_009783.1 A7MXJ7 dimer TATTGTGGATATAATCATT -[1635240:1635258] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) VIBHAR_01626 , VIBHAR_01627 , VIBHAR_01628 , VIBHAR_01629
    ... ... VIBHAR_01626 VIBHAR_01627 VIBHAR_01628 VIBHAR_01629
    604 23839217
    NC_009783.1 A7MXJ7 dimer TAGTAACATGTATGTCAAT +[1646659:1646677]