GlxR - UniProtKB: Q79VI7 regulon and binding site collection of Corynebacterium glutamicum ATCC 13032


Sites are listed as curated.

GTGTTTGTGACTTCGAACATA
TGTAACTTGGCTCACC
TGTGACAGAGTCAACTCTCGG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

GTGTTTGTGACTTCGAACATA
TTGATTGTAACTTGGCTCACC
CCGAGAGTTGACTCTGTCACA

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_003450.3 Q79VI7 not specified GTGTTTGTGACTTCGAACATA +[3226788:3226808] Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) NCgl2920 , NCgl2919 , NCgl2918
    ... ... NCgl2920 NCgl2919 NCgl2918
    821 24795375
    NC_003450.3 Q79VI7 not specified TGTAACTTGGCTCACC +[3227718:3227733] Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) NCgl2922 , NCgl2921 , NCgl2923
    ... ... NCgl2922 NCgl2921 NCgl2923
    821 24795375
    NC_003450.3 Q79VI7 not specified TGTGACAGAGTCAACTCTCGG +[3227780:3227800] Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) NCgl2922 , NCgl2921 , NCgl2923
    ... ... NCgl2922 NCgl2921 NCgl2923
    821 24795375

    GlxR - UniProtKB: Q79VI7 regulon and binding site collection of Corynebacterium glutamicum R


    Sites are listed as curated.

    AGTGAATTACGACACA
    TGAGATGCGCCTCACA
    TGTGAGGCGCATCTCA
    GGTGGCGCACTAGACA
    TGTGTTCTGGGTGACA
    TGCGAACAGGGGCACA
    CATGATCTAAATCACA
    TGTGCCCCTGTTCGCA
    TGTGATTTAGATCATG
    GGTGGCGTGTGTCACG
    TGTGACTGTCCTCATT
    AGTGTCGCAGGCCACA
    AATGAGGACAGTCACA
    TGTGGCCTGCGACACT
    GGTGACCCAGCCCACC
    GGTGGGCTGGGTCACC
    TGTCCTCATGTCCACA
    TGTGAGTCATGTCATT
    TGTGGTTGGTGCCACA
    CGTGAGGGTCGCCACA
    TGCGTAGTGGATCACA
    TGTGTTACACATCACA
    AGTGATCGAATCCACA
    CGTGAAATCGGACACA
    CGTGCATGAATTCACC
    AGTGGGATTCGCCACG
    TGTTAAATGAGACACT
    TGTGATTTCAGACACA
    TGTGGGCAAGCTCACT
    TGTGAGCCCACTCACC
    TGTGATGCATTCGACA
    CGTGATCCAAAGCACA
    TGTGATCCCAGACACT
    AGTGTCTGGGATCACA
    AGTGGAGTCCCTCATG
    AGTGGTCTTTGCCACA
    TGTGGCAAATGACACT
    TGTGGCAAATGACACT
    TGTGGCAGCTGTCACC
    TGTGACCTATAGTACA
    CGTGATCCGTATCGCA
    CGTGGATTCACTCCCA
    TGTATCTCACCTCACA
    GGTGGCACCATTCACT
    TATGAATCACATCACT
    AGTGATGTGATTCATA
    TGTATATCTAACCACA
    ATTGACCCAGATCACA
    TATAACGCACTTCACA
    TGTGATGCTCGCAACG
    TGTGGTCAAACGCACT
    AATGAAGTTTTCCACA
    TGTGGAAAACTTCATT
    AGTGACCTAGATCGCT
    GGTGGTCGGCAGCACG
    GATGAGGTTTTTCACA
    AGTGTCCCGAAACACC
    TGTGGCCTGTCACACA
    GGTGATTTGCATCACT
    AGTGGATTTAATCAAT
    TGTGTCAGATCTCACC
    TGTCTTCTGGAACACT
    TGTGCGAAACGTCACC
    TGTGCAATGCATCACG
    TGTGTCTTCCACCACA
    TGTGAATTACCTCACA
    TGTGTTCCACCCCACA
    TGTGAATTACCTCACA
    TGTGTTCCACCCCACA
    TGTGGGCTGGACCACG
    TGTACTGTACATCACA
    TGTTGACGCATCCACA
    TGTGATTTATGTTACA
    AGTGATCGATGCCTCA
    TGTGATGCACACGACA
    AGTGGACTGGTACACA
    TGTGGTGAGAAACATA
    TGTGATCGACAACATA
    TGTGAGTTAGGTAACT
    TGTGACCTACACCCCA
    AGTGACCCCGCACACA
    AGTGACGTGTATTACA
    TGTAATACACGTCACT
    TGTGAAAACTATCACA
    AGTGACCCAAAGCACA
    AGTGAACGGCGAAACA
    TGTAATCGGCAACACT
    AGTCACATAAATCACT
    GATGATCTACATCACA
    AGTGACGTTTGACACC
    TGTGTCCTGTAGCACA
    TGAGAAATAAGGCACA
    TGTACCACCGCTCACA
    TGTCGGATACGTCACT
    GGAGAACAACGTCACC
    TATGCCGAAGGCCACA
    TGGGTGGTGGGTCACA
    GGTGTGCAACCTCATA
    GGTGATCTGCGTCAAA
    AGTGACACGCGCCACC
    TGGGACATTGCTCACA
    AGTGTTGTAGTTCACA
    GGTGGGCATCGGCACG
    TGTGTCGTAATTCACT
    GGTGGCTACAACCACA
    TGTGGTGTGCTGCACA
    CGTGGCAAAGGTCACC
    TGTGCGTTATTTCACC
    GGTGATGGATACGGCA
    TGTGGATAACCGCACG
    TGTACTGCTAATCACA
    TGTGAAAGCGTACACA
    TGTCTCAATCGCCACA
    AGTAAACGATTACATA
    CGTGGTGGCTGGCACA
    AGTGACCTAAGCTACA
    CGTGAGAACCATCACA
    AGTGCTTAACACCACT
    TGTGACTAATCACACC
    TATGGCATATGTCACG
    TGTATTACAGATCACA
    GGTGACATGGTTCACC
    TGTTCTAGGCTTCAAC
    TGTTGTGTGAATCACA
    TGAGATTTAGCTCACA
    TGTGAGTTGCATCACA
    TGTGTCGATGACCACT
    TGTGGTCAGACTCACA
    TGTGCCTTGCAACACA
    TGTGATAGATCGCACA
    GGTGAGGTTACTCACA
    CGTAGTCTAGATCACA
    GGTGAATATTCGCACA
    AGTGACTGAGGCCACA
    TGAGACCATCGTCACA
    TGTGCAACTATTCAAA
    AGTGTCTTGATTCACA
    TATGACGCAGACCACA
    TGTGCTTCGAAACTCA
    TGTCTCCATTGTCACT
    TGTGATTTAGGCGACA
    TGTGTTTGCAGTCACC
    AGTGGCAAAAGTCACT
    TGGGCGGCTCATCACA
    TGTGGTGGCTGGCACT
    TGTGAGTCCGGTGATT
    TGTGACGAGCACCCCA
    TGTGACGTGGCATACA
    AGTGATTTGAACCACA
    AGTGTTGCTGATCACT
    GGTGACTTCGCCCACG
    AGTGGGGTGCTACACA
    TGTGGGGGATCTCACT
    AGTGACTGGAATCACC
    TGTTGTACATTACACA
    GGTGTTATGGGTCACT
    TGTGTTTCAAATCACT
    TGAGATCTATATCACT
    TGTGAATCACATCACC
    TGTGAGAAGAGACATA
    TGTACAAGCCAACACA
    TGTAAGCAATATCACC
    TGTGGAATATGCCACT
    TATGATGAAATTCACC
    AGTGATAAGCGGCACA
    TGTGACCTGCAACACA
    AGTGACTCAATTCACT
    AGTGACCCTACCCACA
    TGTGACCATACACACC
    CGTGATCTTAGTCACT
    TGAGACCTGTTTCACA
    TGTATGAAACCTCACT
    TTTGTTTACTATCACT
    AGTGATGTGTGACGCA
    AGTGAGTTGAAACACT
    AGTGTTAGACTTCACA
    CGTGTGTCCGATCAGA
    GGTTATCCAGCTCACA
    TGTGGGGCTATGCACA
    TGTGCAGCGCACCACA
    TGTGATTGCCCACGCG
    AGTGCATTAGGTCATA
    TGTGATCTGAGACTCT
    TGTGAGCTGAACTACA
    TGTGAGGCAGCACACA
    AGTGCCAGGAGGCACA
    GGTGAGCTCATGCACA
    CGGGAGTGGAATCAGA
    TGTCACCTGATGCACA
    TGTGCGCGTTGTCACA
    CGTAATGTGGGTCACA
    AGTGATCGAGCGCACA
    AGTGTCGTGACTCACT
    TGTGGTGTGGAACACT
    AGTGTTCCACACCACA
    AGTGGTGCAAACCACT
    TGTGAGATCCACCATA
    TTTGAGTCTCAACACA
    TGTGGCTATCTCCACA
    TGTGGTTGTCGTTACA
    GGTGAGACAAGTTACA
    TGTGATGTCATAAACA
    TGTGTTGTGGGTTACT
    GGTGATTGGTTTGTCA

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    AGTGAATTACGACACA
    TGAGATGCGCCTCACA
    TGAGATGCGCCTCACA
    GGTGGCGCACTAGACA
    TGTGTTCTGGGTGACA
    TGTGCCCCTGTTCGCA
    TGTGATTTAGATCATG
    TGTGCCCCTGTTCGCA
    TGTGATTTAGATCATG
    GGTGGCGTGTGTCACG
    TGTGACTGTCCTCATT
    AGTGTCGCAGGCCACA
    TGTGACTGTCCTCATT
    AGTGTCGCAGGCCACA
    GGTGACCCAGCCCACC
    GGTGACCCAGCCCACC
    TGTGGACATGAGGACA
    TGTGAGTCATGTCATT
    TGTGGTTGGTGCCACA
    TGTGGCGACCCTCACG
    TGTGATCCACTACGCA
    TGTGATGTGTAACACA
    TGTGGATTCGATCACT
    CGTGAAATCGGACACA
    GGTGAATTCATGCACG
    AGTGGGATTCGCCACG
    TGTTAAATGAGACACT
    TGTGATTTCAGACACA
    AGTGAGCTTGCCCACA
    GGTGAGTGGGCTCACA
    TGTGATGCATTCGACA
    TGTGCTTTGGATCACG
    AGTGTCTGGGATCACA
    AGTGTCTGGGATCACA
    AGTGGAGTCCCTCATG
    AGTGGTCTTTGCCACA
    AGTGTCATTTGCCACA
    AGTGTCATTTGCCACA
    GGTGACAGCTGCCACA
    TGTGACCTATAGTACA
    CGTGATCCGTATCGCA
    CGTGGATTCACTCCCA
    TGTGAGGTGAGATACA
    AGTGAATGGTGCCACC
    TATGAATCACATCACT
    TATGAATCACATCACT
    TGTGGTTAGATATACA
    ATTGACCCAGATCACA
    TGTGAAGTGCGTTATA
    TGTGATGCTCGCAACG
    AGTGCGTTTGACCACA
    AATGAAGTTTTCCACA
    AATGAAGTTTTCCACA
    AGTGACCTAGATCGCT
    GGTGGTCGGCAGCACG
    TGTGAAAAACCTCATC
    GGTGTTTCGGGACACT
    TGTGGCCTGTCACACA
    GGTGATTTGCATCACT
    ATTGATTAAATCCACT
    GGTGAGATCTGACACA
    AGTGTTCCAGAAGACA
    GGTGACGTTTCGCACA
    TGTGCAATGCATCACG
    TGTGTCTTCCACCACA
    TGTGAATTACCTCACA
    TGTGTTCCACCCCACA
    TGTGAATTACCTCACA
    TGTGTTCCACCCCACA
    TGTGGGCTGGACCACG
    TGTGATGTACAGTACA
    TGTGGATGCGTCAACA
    TGTGATTTATGTTACA
    TGAGGCATCGATCACT
    TGTGATGCACACGACA
    AGTGGACTGGTACACA
    TATGTTTCTCACCACA
    TGTGATCGACAACATA
    TGTGAGTTAGGTAACT
    TGTGACCTACACCCCA
    AGTGACCCCGCACACA
    AGTGACGTGTATTACA
    AGTGACGTGTATTACA
    TGTGAAAACTATCACA
    AGTGACCCAAAGCACA
    AGTGAACGGCGAAACA
    AGTGTTGCCGATTACA
    AGTGATTTATGTGACT
    GATGATCTACATCACA
    AGTGACGTTTGACACC
    TGTGTCCTGTAGCACA
    TGAGAAATAAGGCACA
    TGTGAGCGGTGGTACA
    AGTGACGTATCCGACA
    GGAGAACAACGTCACC
    TGTGGCCTTCGGCATA
    TGTGACCCACCACCCA
    GGTGTGCAACCTCATA
    TTTGACGCAGATCACC
    AGTGACACGCGCCACC
    TGTGAGCAATGTCCCA
    TGTGAACTACAACACT
    GGTGGGCATCGGCACG
    AGTGAATTACGACACA
    GGTGGCTACAACCACA
    TGTGCAGCACACCACA
    GGTGACCTTTGCCACG
    GGTGAAATAACGCACA
    GGTGATGGATACGGCA
    TGTGGATAACCGCACG
    TGTGATTAGCAGTACA
    TGTGAAAGCGTACACA
    TGTGGCGATTGAGACA
    TATGTAATCGTTTACT
    TGTGCCAGCCACCACG
    AGTGACCTAAGCTACA
    TGTGATGGTTCTCACG
    AGTGCTTAACACCACT
    TGTGACTAATCACACC
    CGTGACATATGCCATA
    TGTGATCTGTAATACA
    GGTGAACCATGTCACC
    GTTGAAGCCTAGAACA
    TGTGATTCACACAACA
    TGAGATTTAGCTCACA
    TGTGAGTTGCATCACA
    TGTGTCGATGACCACT
    TGTGAGTCTGACCACA
    TGTGCCTTGCAACACA
    TGTGATAGATCGCACA
    TGTGAGTAACCTCACC
    TGTGATCTAGACTACG
    GGTGAATATTCGCACA
    AGTGACTGAGGCCACA
    TGAGACCATCGTCACA
    TTTGAATAGTTGCACA
    TGTGAATCAAGACACT
    TATGACGCAGACCACA
    TGAGTTTCGAAGCACA
    AGTGACAATGGAGACA
    TGTGATTTAGGCGACA
    GGTGACTGCAAACACA
    AGTGACTTTTGCCACT
    TGTGATGAGCCGCCCA
    AGTGCCAGCCACCACA
    TGTGAGTCCGGTGATT
    TGTGACGAGCACCCCA
    TGTGACGTGGCATACA
    AGTGATTTGAACCACA
    AGTGATCAGCAACACT
    GGTGACTTCGCCCACG
    TGTGTAGCACCCCACT
    AGTGAGATCCCCCACA
    GGTGATTCCAGTCACT
    TGTGTAATGTACAACA
    AGTGACCCATAACACC
    AGTGATTTGAAACACA
    TGAGATCTATATCACT
    TGTGAATCACATCACC
    TGTGAGAAGAGACATA
    TGTGTTGGCTTGTACA
    GGTGATATTGCTTACA
    TGTGGAATATGCCACT
    GGTGAATTTCATCATA
    AGTGATAAGCGGCACA
    TGTGACCTGCAACACA
    AGTGAATTGAGTCACT
    AGTGACCCTACCCACA
    GGTGTGTATGGTCACA
    AGTGACTAAGATCACG
    TGAGACCTGTTTCACA
    AGTGAGGTTTCATACA
    TTTGTTTACTATCACT
    AGTGATGTGTGACGCA
    AGTGAGTTGAAACACT
    TGTGAAGTCTAACACT
    TCTGATCGGACACACG
    GGTTATCCAGCTCACA
    TGTGCATAGCCCCACA
    TGTGCAGCGCACCACA
    TGTGATTGCCCACGCG
    AGTGCATTAGGTCATA
    AGAGTCTCAGATCACA
    TGTGAGCTGAACTACA
    TGTGAGGCAGCACACA
    TGTGCCTCCTGGCACT
    TGTGCATGAGCTCACC
    TCTGATTCCACTCCCG
    TGTGCATCAGGTGACA
    TGTGACAACGCGCACA
    TGTGACCCACATTACG
    AGTGATCGAGCGCACA
    AGTGAGTCACGACACT
    AGTGTTCCACACCACA
    AGTGTTCCACACCACA
    AGTGGTTTGCACCACT
    TGTGAGATCCACCATA
    TTTGAGTCTCAACACA
    TGTGGCTATCTCCACA
    TGTGGTTGTCGTTACA
    GGTGAGACAAGTTACA
    TGTTTATGACATCACA
    TGTGTTGTGGGTTACT
    GGTGATTGGTTTGTCA

    For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

      Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
      NC_009342.1 Q79VI7 not specified AGTGAATTACGACACA -[1396805:1396820] Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) cgR_1269 , cgR_1268 , cgR_1267 , cgR_1266 , cgR_1265 , cgR_1270
      ... ... cgR_1269 cgR_1268 cgR_1267 cgR_1266 cgR_1265 cgR_1270
      581 20864477
      NC_009342.1 Q79VI7 not specified TGAGATGCGCCTCACA +[18771:18786] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0017 , cgR_0018
      ... ... cgR_0017 cgR_0018
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAGGCGCATCTCA -[18771:18786] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0017 , cgR_0018
      ... ... cgR_0017 cgR_0018
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGGCGCACTAGACA +[38914:38929] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0033
      ... ... cgR_0033
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTTCTGGGTGACA +[53230:53245] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0046
      ... ... cgR_0046
      654 21665967
      NC_009342.1 Q79VI7 not specified TGCGAACAGGGGCACA -[75584:75599] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0064 , cgR_0063 , cgR_0062 , cgR_0061 , cgR_0065
      ... ... cgR_0064 cgR_0063 cgR_0062 cgR_0061 cgR_0065
      654 21665967
      NC_009342.1 Q79VI7 not specified CATGATCTAAATCACA -[75612:75627] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0064 , cgR_0063 , cgR_0062 , cgR_0061 , cgR_0065
      ... ... cgR_0064 cgR_0063 cgR_0062 cgR_0061 cgR_0065
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGCCCCTGTTCGCA +[75584:75599] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0064 , cgR_0063 , cgR_0062 , cgR_0061 , cgR_0065
      ... ... cgR_0064 cgR_0063 cgR_0062 cgR_0061 cgR_0065
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATTTAGATCATG +[75612:75627] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0064 , cgR_0063 , cgR_0062 , cgR_0061 , cgR_0065
      ... ... cgR_0064 cgR_0063 cgR_0062 cgR_0061 cgR_0065
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGGCGTGTGTCACG +[99021:99036] Experimental technique details Beta-gal reporter assay - Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) cgR_0087 , cgR_0086 , cgR_0088 , cgR_0089
      ... ... cgR_0087 cgR_0086 cgR_0088 cgR_0089
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGACTGTCCTCATT -[135506:135521] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0115 , cgR_0116 , cgR_0117
      ... ... cgR_0115 cgR_0116 cgR_0117
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGTCGCAGGCCACA -[135306:135321] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0115 , cgR_0114 , cgR_0116 , cgR_0117
      ... ... cgR_0115 cgR_0114 cgR_0116 cgR_0117
      654 21665967
      NC_009342.1 Q79VI7 not specified AATGAGGACAGTCACA +[135506:135521] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0115 , cgR_0116 , cgR_0117
      ... ... cgR_0115 cgR_0116 cgR_0117
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGCCTGCGACACT +[135306:135321] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0115 , cgR_0114 , cgR_0116 , cgR_0117
      ... ... cgR_0115 cgR_0114 cgR_0116 cgR_0117
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGACCCAGCCCACC -[142013:142028] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0121 , cgR_0120 , cgR_0122 , cgR_0123 , cgR_0124 , cgR_0125 , cgR_0126
      ... ... cgR_0121 cgR_0120 cgR_0122 cgR_0123 cgR_0124 cgR_0125 cgR_0126
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGGGCTGGGTCACC +[142013:142028] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0121 , cgR_0120 , cgR_0122 , cgR_0123 , cgR_0124 , cgR_0125 , cgR_0126
      ... ... cgR_0121 cgR_0120 cgR_0122 cgR_0123 cgR_0124 cgR_0125 cgR_0126
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTCCTCATGTCCACA -[151661:151676] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0130
      ... ... cgR_0130
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAGTCATGTCATT +[226296:226311] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0206 , cgR_0207 , cgR_0208 , cgR_0209 , cgR_0210
      ... ... cgR_0206 cgR_0207 cgR_0208 cgR_0209 cgR_0210
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGTTGGTGCCACA +[252665:252680] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0233 , cgR_0234 , cgR_0235
      ... ... cgR_0233 cgR_0234 cgR_0235
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGAGGGTCGCCACA +[256005:256020] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0236 , cgR_0237 , cgR_0238 , cgR_0239 , cgR_0240 , cgR_0241 , cgR_0242 , cgR_0243 , cgR_0244 , cgR_0245 , cgR_0246 , cgR_0247 , cgR_0248
      ... ... cgR_0236 cgR_0237 cgR_0238 cgR_0239 cgR_0240 cgR_0241 cgR_0242 cgR_0243 cgR_0244 cgR_0245 cgR_0246 cgR_0247 cgR_0248
      654 21665967
      NC_009342.1 Q79VI7 not specified TGCGTAGTGGATCACA +[269772:269787] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0249 , cgR_0250 , cgR_0251
      ... ... cgR_0249 cgR_0250 cgR_0251
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTTACACATCACA -[284796:284811] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0262 , cgR_0263 , gltD (cgR_0264)
      ... ... cgR_0262 cgR_0263 gltD
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGATCGAATCCACA +[302837:302852] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0273 , cgR_0274 , cgR_0275 , cgR_0276
      ... ... cgR_0273 cgR_0274 cgR_0275 cgR_0276
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGAAATCGGACACA -[308275:308290] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0280 , cgR_0279 , cgR_0281
      ... ... cgR_0280 cgR_0279 cgR_0281
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGCATGAATTCACC -[308394:308409] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0280 , cgR_0279 , cgR_0281
      ... ... cgR_0280 cgR_0279 cgR_0281
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGGGATTCGCCACG -[318258:318273] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0291 , moaC (cgR_0290) , cgR_0289 , cgR_0288 , cgR_0287
      ... ... cgR_0291 moaC cgR_0289 cgR_0288 cgR_0287
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTTAAATGAGACACT +[327781:327796] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0300 , cgR_0301 , cgR_0302 , cgR_0303 , cgR_t11 , cgR_0304 , cgR_0305 , cgR_0306
      ... ... cgR_0300 cgR_0301 cgR_0302 cgR_0303 cgR_t11 cgR_0304 cgR_0305 cgR_0306
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATTTCAGACACA -[359493:359508] Experimental technique details Beta-gal reporter assay - Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) cgR_0323 , cgR_0324 , cgR_0325
      ... ... cgR_0323 cgR_0324 cgR_0325
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGGCAAGCTCACT -[387228:387243] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0350 , cgR_0349 , cgR_0351
      ... ... cgR_0350 cgR_0349 cgR_0351
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAGCCCACTCACC -[387254:387269] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0350 , cgR_0349 , cgR_0351
      ... ... cgR_0350 cgR_0349 cgR_0351
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATGCATTCGACA +[402122:402137] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0365 , cgR_0366 , cgR_0367 , cgR_0368
      ... ... cgR_0365 cgR_0366 cgR_0367 cgR_0368
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGATCCAAAGCACA -[406422:406437] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0370 , cgR_0369
      ... ... cgR_0370 cgR_0369
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATCCCAGACACT -[407284:407299] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0371 , cgR_0372 , cgR_0373 , cgR_0374 , cgR_0375 , cgR_0376
      ... ... cgR_0371 cgR_0372 cgR_0373 cgR_0374 cgR_0375 cgR_0376
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGTCTGGGATCACA +[407284:407299] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0371 , cgR_0372 , cgR_0373 , cgR_0374 , cgR_0375 , cgR_0376
      ... ... cgR_0371 cgR_0372 cgR_0373 cgR_0374 cgR_0375 cgR_0376
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGGAGTCCCTCATG +[411455:411470] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0376
      ... ... cgR_0376
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGGTCTTTGCCACA -[412730:412745] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0377
      ... ... cgR_0377
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGCAAATGACACT -[419735:419750] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0385 , cgR_0384 , cgR_0383 , cgR_0386 , cgR_0387 , cgR_0388 , cgR_0389 , cgR_0390 , cgR_0391 , cgR_0392
      ... ... cgR_0385 cgR_0384 cgR_0383 cgR_0386 cgR_0387 cgR_0388 cgR_0389 cgR_0390 cgR_0391 cgR_0392
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGCAAATGACACT -[419735:419750] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0385 , cgR_0384 , cgR_0383 , cgR_0386 , cgR_0387 , cgR_0388 , cgR_0389 , cgR_0390 , cgR_0391 , cgR_0392
      ... ... cgR_0385 cgR_0384 cgR_0383 cgR_0386 cgR_0387 cgR_0388 cgR_0389 cgR_0390 cgR_0391 cgR_0392
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGCAGCTGTCACC +[499448:499463] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0445 , cgR_0446
      ... ... cgR_0445 cgR_0446
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGACCTATAGTACA -[547640:547655] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0491 , cgR_0492 , cgR_0493 , cgR_0494 , cgR_0495
      ... ... cgR_0491 cgR_0492 cgR_0493 cgR_0494 cgR_0495
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGATCCGTATCGCA +[574678:574693] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0513 , cgR_0514 , cgR_0515 , cgR_0516 , cgR_0517
      ... ... cgR_0513 cgR_0514 cgR_0515 cgR_0516 cgR_0517
      654 21665967
      NC_009342.1 Q79VI7 not specified CGTGGATTCACTCCCA -[633769:633784] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0575 , cgR_0576 , cgR_t15
      ... ... cgR_0575 cgR_0576 cgR_t15
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTATCTCACCTCACA +[641995:642010] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0581 , cgR_0582 , cgR_0583 , cgR_0584 , cgR_0585 , cgR_0586 , cgR_0587
      ... ... cgR_0581 cgR_0582 cgR_0583 cgR_0584 cgR_0585 cgR_0586 cgR_0587
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGGCACCATTCACT +[648829:648844] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0586 , cgR_0587
      ... ... cgR_0586 cgR_0587
      654 21665967
      NC_009342.1 Q79VI7 not specified TATGAATCACATCACT -[673633:673648] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0603 , cgR_0604
      ... ... cgR_0603 cgR_0604
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGATGTGATTCATA +[673633:673648] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0603 , cgR_0604
      ... ... cgR_0603 cgR_0604
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTATATCTAACCACA -[682203:682218] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0619 , cgR_0618 , rplN (cgR_0620) , rplX (cgR_0621) , rplE (cgR_0622) , cgR_0623
      ... ... cgR_0619 cgR_0618 rplN rplX rplE cgR_0623
      654 21665967
      NC_009342.1 Q79VI7 not specified ATTGACCCAGATCACA +[705633:705648] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) paaA (cgR_0647) , paaB (cgR_0648) , cgR_0649 , cgR_0650 , cgR_0651 , cgR_0652 , cgR_0653 , cgR_0654 , cgR_0655
      ... ... paaA paaB cgR_0649 cgR_0650 cgR_0651 cgR_0652 cgR_0653 cgR_0654 cgR_0655
      654 21665967
      NC_009342.1 Q79VI7 not specified TATAACGCACTTCACA -[713714:713729] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0656 , cgR_0657
      ... ... cgR_0656 cgR_0657
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATGCTCGCAACG +[759823:759838] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0697 , cgR_0698
      ... ... cgR_0697 cgR_0698
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGTCAAACGCACT -[814771:814786] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0742 , cgR_0741
      ... ... cgR_0742 cgR_0741
      654 21665967
      NC_009342.1 Q79VI7 not specified AATGAAGTTTTCCACA -[850080:850095] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0769 , cgR_0770 , cgR_0771
      ... ... cgR_0769 cgR_0770 cgR_0771
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGAAAACTTCATT +[850080:850095] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0769 , cgR_0770 , cgR_0771
      ... ... cgR_0769 cgR_0770 cgR_0771
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGACCTAGATCGCT +[859636:859651] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0777 , cgR_0778 , cgR_0779
      ... ... cgR_0777 cgR_0778 cgR_0779
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGGTCGGCAGCACG -[869489:869504] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0785 , cgR_0784 , cgR_0783 , cgR_0782 , cgR_0781 , cgR_0780
      ... ... cgR_0785 cgR_0784 cgR_0783 cgR_0782 cgR_0781 cgR_0780
      654 21665967
      NC_009342.1 Q79VI7 not specified GATGAGGTTTTTCACA -[869692:869707] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0786 , cgR_0785 , cgR_0784 , cgR_0783 , cgR_0782 , cgR_0781 , cgR_0780
      ... ... cgR_0786 cgR_0785 cgR_0784 cgR_0783 cgR_0782 cgR_0781 cgR_0780
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGTCCCGAAACACC +[888682:888697] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0805
      ... ... cgR_0805
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGCCTGTCACACA +[901229:901244] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0814 , cgR_0815 , cgR_0816
      ... ... cgR_0814 cgR_0815 cgR_0816
      654 21665967
      NC_009342.1 Q79VI7 not specified GGTGATTTGCATCACT +[918930:918945] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0828 , cgR_0829 , cgR_0830 , cgR_0831 , cgR_0832 , cgR_0833 , cgR_0834 , cgR_0835 , cgR_0836
      ... ... cgR_0828 cgR_0829 cgR_0830 cgR_0831 cgR_0832 cgR_0833 cgR_0834 cgR_0835 cgR_0836
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGGATTTAATCAAT -[936074:936089] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0847 , cgR_0846 , cgR_0845 , cgR_0844 , cgR_0843 , cgR_0842
      ... ... cgR_0847 cgR_0846 cgR_0845 cgR_0844 cgR_0843 cgR_0842
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTCAGATCTCACC -[938456:938471] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0849 , cgR_0848 , cgR_0850
      ... ... cgR_0849 cgR_0848 cgR_0850
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTCTTCTGGAACACT -[938181:938196] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0849 , cgR_0848 , cgR_0850
      ... ... cgR_0849 cgR_0848 cgR_0850
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGCGAAACGTCACC +[939717:939732] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0850 , cgR_0849 , cgR_0848 , cgR_0851
      ... ... cgR_0850 cgR_0849 cgR_0848 cgR_0851
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGCAATGCATCACG +[955305:955320] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0866 , cgR_0867 , secA (cgR_0868)
      ... ... cgR_0866 cgR_0867 secA
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTCTTCCACCACA -[963548:963563] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0875 , cgR_0876
      ... ... cgR_0875 cgR_0876
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAATTACCTCACA -[966296:966311] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0877 , cgR_0878
      ... ... cgR_0877 cgR_0878
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTTCCACCCCACA -[966350:966365] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0877 , cgR_0878
      ... ... cgR_0877 cgR_0878
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAATTACCTCACA -[966296:966311] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0877 , cgR_0878
      ... ... cgR_0877 cgR_0878
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGTTCCACCCCACA -[966350:966365] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0877 , cgR_0878
      ... ... cgR_0877 cgR_0878
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGGCTGGACCACG -[985660:985675] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0893
      ... ... cgR_0893
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTACTGTACATCACA -[1010500:1010515] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0916 , cgR_0915 , cgR_0914 , cgR_0913 , cgR_0917
      ... ... cgR_0916 cgR_0915 cgR_0914 cgR_0913 cgR_0917
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTTGACGCATCCACA -[1010553:1010568] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0916 , cgR_0915 , cgR_0914 , cgR_0913 , cgR_0917
      ... ... cgR_0916 cgR_0915 cgR_0914 cgR_0913 cgR_0917
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATTTATGTTACA +[1033331:1033346] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0934
      ... ... cgR_0934
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGATCGATGCCTCA -[1034604:1034619] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0936 , cgR_0935
      ... ... cgR_0936 cgR_0935
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATGCACACGACA -[1041971:1041986] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0942 , cgR_0941 , cgR_0940 , gltA (cgR_0943) , cgR_0944
      ... ... cgR_0942 cgR_0941 cgR_0940 gltA cgR_0944
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGGACTGGTACACA -[1042000:1042015] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0942 , cgR_0941 , cgR_0940 , gltA (cgR_0943) , cgR_0944
      ... ... cgR_0942 cgR_0941 cgR_0940 gltA cgR_0944
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGGTGAGAAACATA +[1046090:1046105] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0945 , cgR_0946 , cgR_0947 , cgR_0948
      ... ... cgR_0945 cgR_0946 cgR_0947 cgR_0948
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGATCGACAACATA +[1046054:1046069] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0945 , cgR_0946 , cgR_0947 , cgR_0948
      ... ... cgR_0945 cgR_0946 cgR_0947 cgR_0948
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAGTTAGGTAACT +[1046019:1046034] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0945 , cgR_0946 , cgR_0947 , cgR_0948
      ... ... cgR_0945 cgR_0946 cgR_0947 cgR_0948
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGACCTACACCCCA -[1061209:1061224] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_0954
      ... ... cgR_0954
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGACCCCGCACACA -[1123181:1123196] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1015 , cgR_1016 , cgR_1017 , cgR_1018
      ... ... cgR_1015 cgR_1016 cgR_1017 cgR_1018
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGACGTGTATTACA -[1139838:1139853] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1030 , cgR_1031 , cgR_1032 , cgR_1033 , cgR_1034 , cgR_1035
      ... ... cgR_1030 cgR_1031 cgR_1032 cgR_1033 cgR_1034 cgR_1035
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTAATACACGTCACT +[1139838:1139853] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1030 , cgR_1031 , cgR_1032 , cgR_1033 , cgR_1034 , cgR_1035
      ... ... cgR_1030 cgR_1031 cgR_1032 cgR_1033 cgR_1034 cgR_1035
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTGAAAACTATCACA +[1161440:1161455] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1053 , cgR_1054 , cgR_1055
      ... ... cgR_1053 cgR_1054 cgR_1055
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGACCCAAAGCACA -[1166964:1166979] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1056 , cgR_1057
      ... ... cgR_1056 cgR_1057
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGAACGGCGAAACA -[1167074:1167089] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1056 , cgR_1057
      ... ... cgR_1056 cgR_1057
      654 21665967
      NC_009342.1 Q79VI7 not specified TGTAATCGGCAACACT -[1168260:1168275] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_t23 , cgR_1058 , cgR_1059 , cgR_1060
      ... ... cgR_t23 cgR_1058 cgR_1059 cgR_1060
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTCACATAAATCACT -[1183183:1183198] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1068
      ... ... cgR_1068
      654 21665967
      NC_009342.1 Q79VI7 not specified GATGATCTACATCACA -[1183689:1183704] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) cgR_1069 , cgR_1068 , cgR_1070
      ... ... cgR_1069 cgR_1068 cgR_1070
      654 21665967
      NC_009342.1 Q79VI7 not specified AGTGACGTTTGACACC -[1206170:1206185] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558)