qRT-PCR demonstrated CRP acts an activator of arr expression. A PSSM was generated based off of E.coli CRP binding motifs, with higher scores signaling putative binding sites. EMSA confirmed binding of CRP to the arr promoter.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| CTATTTGCTACTGATCACATTT | Shewana3_2342, Shewana3_2343, Shewana3_2344, Shewana3_2345, |
|
activator | not specified |